kittens in cups! (via cuteoverload).

also, cats in sinks.

i hate the president

Via salon (reg req'd, or watch an ad):
Mike Wallace on what questions he'd ask George W. Bush -- who has declined to be interviewed by Wallace -- if he were given the chance: "What in the world prepared you to be the commander in chief of the largest superpower in the world? … You apparently were incurious. You didn't want to travel. You knew very little about the military … Do you think that has anything to do with the fact that the country is so [bleeped] up?"

Also, everyone should read this.

OMG SNOW!!!111!1

nothing sticking at this point, but it's only noon and the forecast is that it's going to keep snowing until 10pm tonight. woohoo!!!

wheedle

edward update!

he continues to show an uncanny ability to locate the "different" or "new" thing. here, he has located my sociology textbook.

he looks ginormous in this picture. wait, he is ginormous.

*sniff*

wow.

watch the video. it's beautiful.

arctic monkeys

via salon... these cute little british boys are renewing my faith in rock music.

omfg

so hot

winner!

happy berfday, tesser

snow on baker.

this is what winter is all about.

12" of fresh powder, and it's not even November 15. This ALMOST makes up for last season. Almost.

ninja!

bwahahaha

“Chillemi said that in choosing who to hire, ‘If it came down between a man or a woman, of course I’d pick the man. The woman would most likely get pregnant and leave’,”

Fox News Sued for Sex Discrimination

talented kitty

this is edward. he has an uncanny knack for finding things on the couch which are not the same as the couch, and showing you these items by sitting on them. here, edward demonstrates his ability to locate my bio lab notebook.

what an amazing kitty.

update:

look, he found my vest.

This parrot is dead!"

bush meets bono

salon has a totally great picture of the president with his arch-nemesis, bono... with some really funny captions. The picture itself is worth a thousand words... you can just SEE the hate-rays coming out of bono's eyes. i guess that's why he wears those sunglasses, because otherwise the president's head would just *bam*

swish

so i aced the second bio quiz. and all is right with the world. exam on friday? no fuckin problem.

i'm all doped up on day-quil, so my brain's been a bit slow today. what follows is a complete non-sequitur. i had lab this morning. my lab group already absolutely loves me because i save their ass a lot. or just save them a lot of work. one or the other. i can't help it, molecular biology just makes sense to me.

the days are getting shorter and darker and I LOVE IT. i'm so excited for winter. too long has my snowboard languished under the bed in disuse. plus i got new boots (that actually fit) and real metal bindings (rather than plastic) last season so i'm good to go. i just hope we don't have another stupid global warming winter like we had last year.

grrrrrrr

oh my fucking god i am so pissed off at my bio ta. so on the first quiz, which was returned to us today, i got a fucking 19 out of 20. so i look to see what i'd done wrong because I KNEW i had aced that quiz. and I see that i've been docked a point because the o and the l in the word "Golgi apparatus" are a little close together so it looks like I wrote "Gdgi apparatus". OH. MY. FUCKING. GOD. YES I REALLY THINK IT'S CALLED THE GDGI APPARATUS. WTF.

I shouldn't be seething about 1 point on a quiz, BUT I AM.

before i die i will do this

dogsledding on svalbard

i was just playing with google maps, when i found this island north of russia and norway, about on the same latitude as the north end of greenland, and i was like, hmm, what is this place? so i wikied it. it looks beautiful. so i randomly found this site for this "resort" type place, where you can stay in longyearbyen, which is the "major city" on the island (pop. less than 2000) and take a 3-day dogsledding adventure to a ship frozen in a fjord. where they have modern amenities and a cozy little hotel. it just sounds so fucking cool... plus you get to pick your own puppies and take care of them for the duration of the trip!! puppies! just waiting, hoping you'll let them go on a trip running with their buddies across the arctic. and the only sound you can hear is the doggies running on the snow. i must do this before i depart this earth.

liek omg

the best thing evar happened before biology lecture today... a girl got up to make announcements about tri-beta, the biological honor society, and their goings-on. so she gets up and giggles and tells us about tutoring, and omg, like mentoring and stuff, and then the biology club meetings, the first of which is this thursday at 6pm, where we'll be talking about, um, intellectual design, so you should all like, totally come!

biology honor society my ass. intellectual design, omg! u r so smart. i wonder if she was just ditzy because she was in front of 200 people, or if she really has no perspective on what intelligent design is.

blogging from the starbucks on the ave. funny thing is, within the walls of starbucks, there are 3 available wireless networks, only one of which is starbucks' t-mobile proprietary pay network. so i'm sticking it to the man, and to everyone who thinks you should pay for wi-fi.

just got out of my first sociology section. everyone was really quiet. i hate sections like that, where no one ever says anything... maybe it'll get better as the quarter goes on. there's a girl in there who's a new orleans "displacee" (is that better than refugee?) and we talked for a few minutes about the hurricane and how it caused a diaspora... and the TA said "hundreds, thousands of people... maybe even tens of thousands." try again, blondie, it was hundreds OF thousands.

yeah, my TA in that class is this 5'9 perfectly groomed blonde princeton grad with a ginormous diamond on her left hand. how fucking typical.

bio lecture in an hour... i'll finish my coffee here and then get some teriyaki across the street. mmmm, teriyaki. and then it'll be time for class. whee!

the sounds of hell/school starts tomorrow

there's been the sound of someone playing a recorder very poorly floating through our apartment since i woke up at around 8. i'm guessing this is the doing of a third-grader, because i remember last time i was at my aunt and cousins' house, my little cousin zoe had a recorder and played it poorly. it's one of those things that you do in third grade. but why, for the love of god, has this horrid noise been going on for the last two hours??? it's pretty clear that the person playing the recorder knows no more than two notes, three if you count that god awful sound that a recorder makes if you just blow harder. if i were wearing pants, i might go investigate, and possibly throttle the little bastard. alas, i am pantless.

on another note, i think i'm really going to like this whole not-working thing. i didn't get out of bed until 9:30. my class schedule won't allow me to sleep in that late most days, but for one day it was really nice.

speaking of class schedules:

monday: bio 200 lecture, 12:30-1:20
tuesday: soc 212 lecture, 9:30-11:20, bio 200 lecture, 12:30-1:20, near e 210 lecture, 2:30-4:20, swim conditioning, 6:00-7:00
wednesday: bio 200 lab, 9:00-11:50, bio 200 lecture, 12:30-1:20
thursday: soc 212 lecture, 9:30-11:20, near e 210 lecture, 2:30-4:20, swim conditioning, 6:00-7:00
friday: soc 212 quiz, 10:30-11:20, bio 200 lecture, 12:30-11:20, near e 210 quiz, 2:30-3:20

soc 212 is "evolution and revolution: an introduction to comparative social change".
near e 210 is "introduction to islamic civilization".
bio 200 is intro biology. durrr

oops. changed my mind again.

sassy

avast, ye landlubbers. it be talk like a pirate day. ahoy, yarr, all that good stuff.

so thus begins my last full week of work. classes start next wednesday, the 28th, so i'm calling it quits after this week. well, i'll be coming in on mondays to help out with training and such for a few weeks, but it's not full-time so it doesn't really count.

today at work i laid out my 4 year plan - which turns out to only be a 2 year plan. it seems that i can get all the coursework i need into 7 quarters - so i'll take 10 units next summer, and a full-time load every other quarter - and graduate next winter or spring. well, get my undergrad degree then, as i fully intend to pursue More of the Same and then Pile it Higher and Deeper after i complete my B.S. degree.

edward is obnoxious; i have laundry; i think we're having tortelloni for dinner. not to be confused with tortellini. duh.

i am so punk rock.

i am trinity.

i have a dirty mirror.

fuzzy trees

been awhile. bad blogger.

had a good camping trip this weekend, one in which i got to cuddle with tessa and we saw lots of big trees. no one else would have noticed these big trees if i hadn't pointed them out, see, look there's a big tree. it's helpful to have a biology major along for these kinds of things.

better than big trees, however, were the fuzzy trees.

we went over to the olympic national park, up the elhwa river valley. it's not quite rainforest over there, but we were certainly in a forest, and it did rain a bit. just a bit, one night.

we hiked something like 6 miles on saturday, and boy was that a pain in the ass. we're going to have to get our stamina up before we can do that epic hike i keep talking about. i want to hike up the hoh river valley, all the way up to the glaciers at the base of mount olympus. one day, i want to climb mount olympus. it's only like 8000 feet.

this lake is going away soon. the dam holding it back was built in 1913 and frankly, it looks like it might be time for it to go away. the dam is all cracked and dilapidated-looking. we met an old couple at the lake overlook and they seemed pissed about the idea of taking down the dam. i say, we got a bit overzealous with our whole nature control back when the army corps of engineers was new and mother nature won't put up with our shit forever. so it's better to take down the dam in a controlled way than wait for it to go boom and send huge blocks of concrete down the valley at a hundred miles an hour.

tomorrow is haircut day. stay posted.

i've been pretty pensive recently. mostly because of hurricane katrina, i think. it's weird. i lived outside of NO in '92 - which if you know your hurricane history was the year andrew struck - and i remember it being a pretty wild ride, though it was only a TS when it hit louisiana, not the cat5 hurricane it had been thru florida. but still, having lived there for 2 and almost a half years during my childhood i know the lay of the land, i have many memories of that city and its amazing waterfront aquarium and the french quarter and the superdome and my dad's office off poydras. and now that is all under 15 feet of water and it just seems surreal.

the thing that makes me so mad is the revelation that the feds have red-lighted several projects to improve levees and shifted their focus away from hurricane preparedness. it's all a part of the integration of FEMA into the department of homeland security. and the shifting of all "available" funds to the iraq war. it's absolute, utter bullshit.

not a lot to write about recently, so i haven't. it's been a boring week. i had a fucking cold this week, it was lame. and i'm still hacking up wads of phlegm. earlier today a phlegmwad shot out of my mouth and landed on the couch. i'm sure you wanted to know that.

meh. still no update from school, except i got my transfer credits evaluated (but not for ger's) and i'm officially a resident it seems. not that there was much question about it, i live here.

bleh.

bombshell

wtf.

dept. of stupidity

man, i really hate bureaucratic crap. since i didn't get admitted the first time around, i was delayed by a month in signing up for my stupid summer orientation and registration day, and the next available one for my major is on september 7. that's 3 weeks before classes start. so basically, i can't count on getting the classes i want or need, since they're all already full. if i could register now, i could lurk on the registration page, waiting for someone to drop (or get dropped). but now, even if spots in either of the crucial classes i need open up, i still can't register. this really, really makes me mad. i'm probably going to end up taking a whole lot of bullshit fall quarter if i don't have incredible luck.

i just talked to my boss, too. they are really upset that i'm leaving, but they won't let me stay on in the same position part-time. which sucks. they offered me a part-time mailroom position, but to that i say FUCK NO. been there, done that, won't go near that again. hopefully the office of financial aid will come through saying i'm eligible for work-study soon, so i can pursue one of a few work-study jobs that look cool (most of them involve washing glassware and preparing specimens; one of them involves caring for zebrafish. i'm hoping to get that one). unfortunately, work-study jobs are generally 10-15 hours a week and pay about $10 an hour. which means i'd be bringing home somewhere in the neighborhood of $400-500 a month. which is entirely unacceptable unless i get additional financial aid offsetting my housing costs. bleh. so much rides on the anonymous decisions of faceless bureaucraps right now.

omgwtflol

kitty and kat watch fish.

christopher walken for president in 2008

the ballard beach at sunset on a friday is a happening place.

soybeans and boobies

the great thing about saturdays is that i don't have to get dressed until i want to. i just rolled out of bed (remarkably hungover; i didn't think i had THAT much to drink last night! oh well, it was all free (thanks ross/jason!) so i suppose it's all good) and am now eating tofutti for breakfast, wearing nothing but underwear. i love being a grown-up sometimes.

oh, and for the record: tofutti is a perfectly acceptable ice cream substitute. the texture's a little different - smoother, harder - but it's so creamy and yummy and delicious, and it doesn't give me lactose issues. hooray.

incidentally, i've been boosting my soy/tofu intake, because soy products contain phytoestrogens and are supposed to make your boobs bigger. i'm only on day 5 or 6 of this experiment and i can definitely see results. i should market my diet.

that's right, motherfuckers

if anyone was wondering how to get into the university of washington, here's my advice: when you petition your rejection, tell the admissions people that they are killing small children by not admitting you to the u. it works, really. though i suppose it's less of a stretch for someone who wants to study developmental biology and genetics than it would be for, say, an english major... but details.

suddenly i'm actually proud of myself for getting into college. this was never supposed to be hard. gah.

i will post this on craigslist so god help me

kitten for sale. $5.

ok, not much of a kitten, he's about a year old, black, real purty kitty. not too bright, but he loves to play. went fucking psycho tonight and catapulted (ha ha) himself around the house, peeing on the furniture. yes peeing. maybe spraying. whatever it was it was yellow and smelled of cat. i thought at first that it might be an earthquake - shit was rattling, then it turned into thumps, and crashes, and scrapes, and mrrrrroooowwws, until he must have pissed himself dry. he's been real docile ever since, all cuddly, out of breath... but i'm not fooled. my cat has never been more afraid to approach the litterbox, or the couch, or the bedroom. he has her petrified. poor baby.

so if anyone wants a kitty, let us know. you must be a good home, and have plenty of room for him to romp around. another young male cat would be ideal, but no females.

lilies

i promise, more has been going on than just wallowing in self-pity over my rejection letter. i have a date with an admissions counselor on monday to discuss my application (and, with any luck, bamboozle them into letting me in). and if that fails, then i'll just have to wait until winter, because if i apply to the actual major i want, and write an essay about why i want to do it, and show them my bio 180 grade, there's no way they will turn me down. i'll be like rudy.

edward is hot and annoying in this weather. i'm also out of sake, so i might have to go to the market to retrieve some. i feel like fresh fruit too... perhaps blueberries. mmmmmm.

i've kind of taken over jared's sims game. our sims had a baby who is now a kid. is it weird that the sims brings out my maternal instinct and i very fleetingly find myself wishing i had one? don't worry, i'm not going to have one. not until i've got at least two academic degrees. that's my plan, at least. i almost put the phrase "at least" in those last two sentences a total of four times. i cut it down to two. go me. but whatevs.

speaking of silly little word-shortenings, i got an evite to a fashion industry event that repeatedly refers to "models, photogs and designers." i can hear the girl that sent me the evite saying it, too... "so did you get a photog for this? it was supposed to be tfp..." haha. oh well, i'll probably go, since it's free food and a chance to get boozed up on a thursday night. i need to make some comp cards before then. ergh.

speaking of models, i ran into anna (say it with a long A, not a short one) from the neodandi show on the bus. didn't get to talk to her much since she got on the stop before i got off, but it was cool to see her... odd that we always run into each other. actually, i suppose not, because we live like 7 blocks apart in a neighborhood that is very outdoor friendly. she's pretty cool.

speaking of on the bus, i sat across from an anorexic girl on the way home today. i couldn't stop staring. fortunately she was oblivious, absorbed in her book and her very slowly nibbled baby carrots. this was my inner monologue. "oh god, look at her wrists! holy crap she's hairy. i shouldn't be staring. oh, poor girl. man, watch the self-restraint as she nibbles those carrots. man, i'm lucky i'm not genetically predisposed to anorexia, since there have definitely been times that i've cultivated unhealthy eating habits. wow, her skin looks terrible. look at those calves. i bet she's a runner, too. wow, it sucks to be her." i'm going to hell.

if there were any such thing as hell. ha. instead, i'm going to the market after fresh fruits and sake. mmmmmmm.

biology test: 110/120. high score: 113. low: 24. average: 84.

number of students in class: 240 something.
number of students in class that just got rejected by the university: 1

something isn't right with this math. but i've got a meeting with an admissions counselor on monday, to talk about my application. and basically tell them to let me in. because something doesn't add up here.

yes, i'm still bitter.

god fuck fuckity fucking fuckity dammit. motherfuckers fucking fuck fuckity fuck fuck.



i fucking hate the uw admissions fuckers. and i feel like a failure right now.

fragments

the rain falling from the uniformly grey sky makes me feel closer to london. two cop cars in the university street tunnel, one unmarked, dark blue. their drivers standing in between the bus lanes, engaged in conversation, their presence absolutely obvious. an elderly sikh man in a turban gets off a bus and waits for another. i feel guilty for wondering how many suspicious eyes he will elicit today. at westlake, a uniformed officer steps on the bus, looks around. he gets off at convention place. evidently terrorists wouldn't strike outside the bus tunnel. i feel an emotion unfamiliar in the presence of law enforcement: slight reassurance.
seattle would be a terrible place to stage an attack, anyway, there's no political value in it, not since '99 anyway. for once i feel a bit glad at the inadequacies of our public transportation, a bit safer that we have no subway.
the bus takes eastlake instead of getting on the freeway. i wonder why.
and on the way back, between the westlake station and university street, the bus stops cold. no announcement from the driver, no apparent reason, just stopped in the middle of the tunnel. ten minutes later it starts again. no explanation.
honestly, i'm more worried about kim jong-il and his rogue nukes, or even mother nature and her volcanoes, but

big weekend.

flickr is being poopy, but hopefully by the time i'm done writing this i'll have pictures.

so the summer of fun continued last weekend with a jaunt out to tessa's hometown, tahuya. (also known as god's country*).

it was cool because saturday was the annual Tahuya Day parade complete with horses and floats and people in golf carts. and this guy.

i got the feeling that he wasn't particularly dressed up.

tessa's dad makes great bloody marys.
her family enjoys a variety of boating-related activities, including kayaking and water skiing. unfortunately, no pictures of those, as i was paranoid about getting my camera soggy. but it was amazingly fun. i love kayaking. and water skiing. i'm not very good at swimming, though, i've discovered. probably because hood canal is still part of puget sound and thus really really cold, and when i jumped in my body went into slight shock and i couldn't breathe well. also i have no body fat to make me float.
so we spent saturday enjoying tahuya day and then when the tide came in we took the kayaks out, and then took the ski boat out for a zip around the canal. it was overcast and too damn cold to ski, but we enjoyed ourselves thoroughly. i sat in the front of the boat with a shit-eating grin on my face giggling every time tessa hit the throttle or went over another boat's wake.
saturday night we 'sploded things.


and on sunday i got a monstrous sunburn on my legs, because i decided though i needed sunscreen everywhere else, legs don't get sunburned. what. the. fuck. i also got up on the first try on water skis (go me!) and even managed to wakeboard a little. i was the undisputed water sports champion. no one else even went swimming (wussies).
sunday night was fireworks up on the hill. that's where that first panorama shot came from.
and this was me on monday evening when we finally got home, pooped and doing my "i miss kayaking after dinner" face.


*i mean this in an entirely non-ironic way. as in, this is a place that is as god intended. for all theoretical values of "god."

shit.

shit. shit shit shit shit shit.

omgomgomg

so i just discovered that everyone's favorite top model loser, elyse sewell, has a livejournal!!!

and she actually writes in it and posts pictures and is funny! (duh.) anyway, worth a look, esp if you like... uhh... looking at pictures of models. she is a mistress of self-portraiture as well... i wish i could take a self-portrait that didn't make me want to poop on it. :p

obligatory tom cruise post

so, when this whole tom cruise/katie holmes thing started, i told tessa (and maybe a few other people) my theory: that he's totally gay, and that this whole katie thing is a pr stunt paid for by scientology to keep this gayness under wraps in exchange for him proselytizing all over the place. i knew this to be true, deep down inside. and now, the superficial is corroborating my story. ok, so it's fourth-hand gossip now, but still. i was totally right.

ha.

such a yuppie

i've got a new drink at starbucks. a triple-tall americano. half the price of a double-tall hazelnut nonfat latte, and fewer calories to boot. plus i can add a splash of nonfat milk, some splenda, and a dash of vanilla powder to make it super-yummy without bugging my tummy (fucking lactose).

long ago in a distant land...

so today during lecture i sat down and noticed THAT GIRL sitting in front of me. i thought to myself, good, if she says anything stupid i can KICK HER. i didn't, i restrained myself. but at one point during the lecture she went to ask a question, and this girl sitting a few chairs over from her (no one between them, but not next to her) leaned over and asked what her question was. taking one for the team! i wanted to give her chocolate or something for that. unfortunately later on the instructor did see her raised hand and bit. dammit. oh well. hopefully we can count on the continued assistance of the altruistic question-answerer. something tells me no though.

samurai jack tonight, yo.

that girl

why does she have to be in my bio lecture? why, god, why?? you know the girl i'm talking about... she sits in the front row and has frizzy hair and asks STUPID questions. questions that derail our already ramble-prone lecturer and leave 90% of us rolling our eyes. it's not as if this class wasn't already painfully slow, why must you slow us down further?

i can't wait until i'm done with all these intro classes and i can take classes that actually fascinate me.

speaking of fascinating things, you know that construction at the intersection of 15th and pacific? yeah that's the new genome sciences building. genome sciences. how. fucking. awewsome.

i watched a nova special on the genome last night. other than the fact that the interviewer was this british guy that reminded me a little too much of carson from queer eye who asked questions from a complete lay perspective, it was really good. i learned about the proteome. that's like the genome, but instead of genes, they're coding proteins. because that's where the complexity is now... we've decoded the genome into CGATTATAGGCCCGATACCAGT but we can't read that shit. now we need to figure out what all the proteins that the genome codes for are, and what they do. proteins are fucking rad. all they are is long chains of amino acids that fold in a specific way. each protein has a unique shape. its shape is its job. if a protein is misshapen it can't do its job. so we end up with sad genetic disorders like tay-sachs.

chew on this one for awhile. in tay-sachs disease, one (ONE) letter of DNA is missing, so one amino acid in a specific protein doesn't work right. it just happens that this protein is the one that's responsible for removing fat deposits from the brain. so, until the child is about a year old, they appear to be developing normally, then that development slows down, and as the fat deposits suffocate the brain cells, their development actually reverses. these kids never make it much past age 5 or 6, and by the time they're that old, it's like they're an infant again. can't sit up, turn over, swallow, anything. it's absolutely devastating. and all because of one little C or G or A or T out of place.

.

happy things/sad things

happy thing: sandwiches. sad thing: sandwiches which are all gone.

ohh, gregor mendel

so i'm back at work after my first bio 180 lecture. it looks like, at this point, there's a roughly 84% chance of me getting into the class. There are 5 spots open and 6 people raised their hands in lecture to the question, "who is trying to get into the class?" so that's pretty rad. the class looks like it'll pretty much be a breeze, but i'm going to actually buckle down and study hard no matter how easy it seems, so i can be that fucker that makes the curve. :D though i won't know for sure until thursday whether i'm in or not. i have to go to the first lab section thursday morning and hope.

i totally forgot to bring something to write with to lecture today, so i had to borrow a pen. on the first day. why does that always happen to me? :p oh well.

anyway this class is on evolution, mendelian genetics, and biodiversity. the biodiversity part sounds super-cool because there are field trips involved. one of which is to friday harbor, and one of which is to the olympic peninsula. fuckin' sweet. i really want to do the friday harbor one. because san juan island has to be beautiful. also, i love sea critters.

meh. so now i have to go buy the lab manual. and if i get into the class i'll have to buy the textbook too. and pay tuition. :p i'm pretty sure my parents are going to help out with that one... since i'm poor.

so now i'm stuck at work for a long time since i skipped out on 2 hours to go to class. tomorrow i'm going to get up earlier so i can get to work by about 7:30 or 8 so that i don't have to stay until 7pm to make up for my missed lecture time. whee.

all the successful ones are dropouts

OK, I know this news is like a week old, but it's been circulating the net so much that I kind of feel I need to comment on it. It's about Steve Jobs speaking at Stanford's graduation. You can find the text of his speech here. It's definitely worth a read.

So, speaking at the graduation that, for all intents and purposes, should have been my own, Steve Jobs, who never graduated from college, says that dropping out was the best thing he ever did. Really, this speech did a lot for me this past week - I have been having pangs of guilt - feeling like I'm a lazy fuck, like i'm a failure, like I should have just stuck it out. But really, when I think hard about it (or even not that hard) I remember just how painfully unhappy I was those last two quarters at Stanford, and remember that if I'd graduated last Sunday, it would have been in Product Design, which is a very fucking awesome major, but not what I'm good at at all. I probably would have been a miserable failure, I know I never would have gotten a job with Apple or Ideo, and well, I'm just not all that creative at heart, as much as I wish I were. And now that I've found what I really am passionate about, I really am a lot happier. :)

(ok, living with my super-hot amazing boyfriend doesn't hurt, either. ;)

is wayne brady gonna have to chokeabitch?

i hate people today. all of them. i've been having violent fantasies all week. this morning on the bus i repeatedly shot a kid on the bus with my pretend-gun because he kept asking the driver dumbass questions. also because he was poorly dressed with thick glasses with clip-ons. honestly, who wears clip-ons anymore? at least they weren't flipped up. i guess i'm just prejudiced against the socially inept.

then today before lunch some bitch called demanding payment for some cd-rom her company sent me without solicitation. when they called before it was shipped i said, no, i don't want it! and then they sent it. and i was like, ok, whatever. then today, i got a $417 invoice for the damn thing. for a fucking CD-ROM! i mean, honestly, if you're going to overcharge, at least use up-to-date media. i could deal with paying $417 for a holographic information card. or maybe a 2GB memory stick. but a CD-ROM, hell no. so i sat there and tried to get it resolved, all the while wishing i had a "choke-a-bitch" button on my phone.

then on the bus on the way back from lunch some coworker of jared's started going off on pussy liberals talking about their feelings. oh. my. god. i only had 2 blocks until my office so i kept my mouth shut, all the while seething inside as these two coworkers of his proceeded to talk about why mexicans are bad for the u.s. economy and how they are just here to rape and kill people. duh, that's why our prison system is 30% immigrants! yeah, well maybe these people became violent criminals after they arrived in the us and realized how fucking stupid the people here are, and decided that maybe they deserve to be killed.

i also had a violent episode on wednesday night playing mario party. i had hoped that would get all the anger out of my system, but nope, people kept on pissing me off yesterday and today. dammit. at least he didn't turn around and call me an abusive girlfriend and a horrible person and make me feel guilty on top of my anger like a certain ex of mine did.

so yeah, it's been anger-management week for kat. i just don't get why i've been so twacked out. i blame the new birth control. i suppose it's a small price to pay to not worry about popping out a kid or two while i'm not paying attention...

had an odd dream last night - it was about my cousin's wedding. (he's getting married in july. which is so weird to me.) anyway, we were getting ready for the wedding, and evidently it turned out that his fiancee is some minor royalty, so the queen of england was going to be there, even though it was a really informal, small ceremony. so everyone was fussing about, getting ready for the queen. and the wedding. there was also something in there about trying to get my mom set up to use my old ipod (as if i had an old one going unused), but we couldn't find a dongle (not sure why it was called that) to convert firewire to usb, and the ipod kept giving us friendly error messages. it was kind of funny and sarcastic. then, as we were sitting down for the wedding (someone had offered me a juice with vodka in it - seemed a little early, but i took it since it was stressful times, the queen was coming!) and suddenly a tree in the yard was on fire. so i started screaming and pointing, and no one would look the right way. i tried to call 911, but i got a phone maze ("thank you for calling 911 emergency services. all our agents are currently on the line.") and then i woke up.

moanday...

so the bus was 20 minutes late this morning, prompting myself and probably everyone else waiting for it to wonder if i'd missed it. turns out i hadn't, it was just 20 minutes late. without explaination. meh. so i was a little late getting into work this morning, and my double-tall hazelnut nonfat latte (yes i hate myself for using that many words to order a fucking coffee) completely failed to wake me up. so i spent most of today in a half-awake stupor. i did read some stuff on wikipedia about g-proteins, and rod and cone cells, and kind of how they work, which was neat. i also learned about cnidarians and that if you take two different kinds of sponges (the simple aquatic animal, not the kind you use to wash dishes) and put them in a blender and make sponge-shake, then let them sit and settle for a few weeks, the sponge cells will reassociate with their own kind and reform sponges. they sort themselves out. pretty fucking cool, huh. kind of makes me wish i had my own sponges to play with.

which brings me to the next car in my train of thought. i want to set up a marine tank. with live sand and rock and maybe a few fishies. eventually i want to have a huge coral tank with some sweet anemones and shit, but that stuff is expensive. goldfish are cute, but boring. i want itty bitty critters crawling around in my substrate.

this weekend was pretty cool. friday night andy (with whom i attended high school, back in helltexas) and some college buddies dropped by on their post-collegiate road trip. went to pies and pints for dinner, where we ran into the tessanator and had a lovely meal. went back to our apartment and drank. a lot.

saturday was my grandma's birthday, so jared and i went over to bellevue to hang with the Fam for the afternoon. saw plenty of family-types. my cousin krissy came over to our apartment and hung out for awhile, mostly to escape barney, who had infected our grandparents' television (much to the delight of almost-four Lauren, who is loud and talkative now). fuck barney. so then after she went back to bellevue, we headed out to a par-tay at some friends of tessa's on cap hill. much beer was drunk. met a new blogger chick who seemed pretty cool. saved tessa from certain doom at the hands of an asshole. danced wildly to annie, the swedish pop star. (note to self: find her music.) and other such party-tastic activities.

sunday i got a wee sunburn. hooray! i'm a little bit tan now (though still solidly in the "ridiculously white" category). also, had a rehearsal for the upcoming neodandi show. it's in july. we're going to have 3-hour rehearsals for this one. whee.

why do i always end up doing epic summary posts instead of shorter on-the-fly posts??

the perils of living in the northwest

i had a dream last night that i still remember pretty vividly, so i figure i'll share it. it started with an earthquake. i can't remember what building i was in, probably not any real building, but i remember feeling the ground moving in one direction, like a large chunk of land mass was sliding. so i jumped up and stood in a doorframe like you're supposed to do in an earthquake. only it didn't stop, it just kept going. i could see where it was going - we kept sliding out into the sound, then busted through some bridge (if there were a bridge across the sound around here), and kept on sliding until we were pretty far from where we started. so we decided to evacuate. at first this was done by running as fast as we could in the same direction as we were moving, trying to get to where we could see the ocean. my dad was there. he said that we had to get off of the moving land before it fell off the continental shelf. that sounded scary. suddenly there was a big hill in front of us (that i remember someone called "mt. hill." ha.) that i couldn't make it up. and then we saw other people, and they were all going the other direction, back towards the land. at this point we realized that what had happened was mt. rainier had blown, and we were on one of the lahars that was moving out to sea. so we started moving in the other direction, first stopping back at our house to grab stuff. i tried to stuff frida into my backpack but decided against it. i think i ended up carrying her off. so then we got into a car somehow and were driving back towards the land, trying to outrun the still-moving land mass and get to safety. someone mentioned something about "you think we're screwed, i just heard that car dealership central is completely demolished." somehow i knew that car dealership central referred to the renton/auburn valley. we kept on going, driving as fast as we could in the clogged 2-lane street to get to safety. then i woke up.

so then i started thinking about the inaccuracies of my dream. first of all, lahars don't carry large land masses and things with them, they just blow them out of existence. second, if mt. rainier really exploded, we here in seattle would have at least some advance warning to evacuate. i'd put my kitty in her carrier, rather than shoving her in a backpack or carrying her by hand. and then we'd head north on i-5, as fast as traffic would allow. and auburn and renton would probably be nonexistent. these are things you gotta think about, living in the shadow of the most dangerous volcano in the country. not obsess about, mind you, but at least be aware of, so should that day ever come, you can deal with it without completely panicking.

department of narcissism

new flickr pictures from the fashion show - by robert contreras... some of these turned out really cute. check them out. i'm slowly starting to feel like maybe i can photograph well after all. now i gotta learn how to do my own makeup :/ 'cause that's the key.

camping was swell. there are camping pics up there on flickr too. you can see them here. we should do that again sometime soon. :D

i give my hand, you take my arm

Thanks, Mike, for passing me the baton. I don't usually do this sort of thing, but I'm bored, waiting for everyone to get here so we can go camping, and you told me to, so I will.

Total volume of music on my computer: According to itunes, 2792 songs, 8.7 days, 12.95 GB. I know, I'm a n00b. But I lost all when I upgraded to the Mac.

The last CD I bought: The Life Aquatic with Steve Zissou OST. It arrived in the mail today and it is awesome.

Song playing right now: "Starman" written by David Bowie, translated into the Portuguese and performed by Seu Jorge (who appeared as Pele in the movie). Acoustic Bowie in Portuguese. What could be better??

Five songs I listen to a lot, or that mean a lot to me:
Such Great Heights, The Postal Service. It's "our" song.

The Only Living Boy in New York, by Simon and Garfunkel. The Garden State soundtrack is amazing, and I figured if I could only pick one song off the album, it'd be this one.

Welcome Home feat. Mike Ladd, by Daedalus. Again, amazing album, favorite song. It's really smooth rap lyrics over an awesomely melodical song. Plus he uses the word "megadebauchalopolis" which I think is awesome.

It's A Fire, Portishead.

Love Ridden, Fiona Apple. This album (When the pawn hits...) carried me through some of my angstiest high school years. I still know the whole title (it's in the guiness book for being the longest album title ever) - ask me sometime.

Five people to whom I'm passing the baton: Jared, Tessa, Ruben, Andy and Lauren. Shit, I don't even know if five people read this damn thing.

That was fun. We now return to our regularly scheduled programming.

is that my espresso machine?

watched the life aquatic tonight with steve zissou for the second time. i may need to buy this movie. if you haven't seen it, rent it, because it is amazing. i'm also expecting the soundtrack to arrive from amazon by thursday or friday. the soundtrack is as good as the movie.

i got an email from neodandi today asking me to be in their next show, which is tentatively scheduled for july 15. and so i have a fitting on thursday at 1pm. :D this show is going to be smaller and "more refined"... so we'll see what else they have in store for me. oh, and my family's going to be in town around the 15th, so hopefully they can come see. i'm happy.

noooooooooooooo!

yeah, so we went to go see star wars episode iii yesterday... omg that sucked. up until anakin joined the dark side and started going ape shit. then it was okay, except for the whininess and the bad, bad lines.

after star wars, we went to zao for dinner where tessa and i shared some sake, and then we watched the life aquatic with steve zissou. great movie. i'm going to have to buy the soundtrack. this is annoying because it is not on itunes so i'll have to order the cd and wait. :/

photos by gabriel choy

from the p-i

Seattle designer revs up with fast-foward, curve-hugging garments

check it out!!! no pics of me, but it's great coverage. :D

neodandi!

so the big show was last night, and it was absolutely awesome. pandemonium backstage, excellence onstage. i wasn't supposed to be in the finale, and i didn't rehearse that part at all, but then at the last minute, the designer handed me an outfit and told me to put it on. fuck yeah. so that was cool.

what wasn't cool was the fact that my camera batteries died after just one shot backstage. fortunately lots of other people got pictures, so i should be getting some of those soon, once they are uploaded. i also got a bunch of professional shots taken once i got done with hair and makeup, and also during the show, and backstage, so with any luck i can get some copies of those as well. i'm hoping to get a few 8x11 glossies out of those shots too, so i can start building a portfolio. might have to pay for those, but hey, if they're good pics i'll pay.

so i'll post more on the show once i get some pictures.

my computer needs a cupholder. i mean really, where am i supposed to put my glass of wine while i'm typing a blog entry? it's too bad my cd drive is a slot instead of a tray... lol.

had a rehearsal tonight for the neodandi show... it's really coming together. we rehearsed tonight for the first time at trinity, where the show is... it is a fucking tight club. awesome furniture. i'm really getting stoked for the show. it'll also be kind of nice to be done with rehearsals for awhile. maybe i can start going to yoga again once a week or something. though i'll really be sad for it to be over, because then i won't really have a project.

though i did have an interview on friday with a guy whose friend is starting up this t-shirt company. no guarantees, but it's a lead. plus, i'd get some portfolio shots out of the deal.

i just got an email from the university of washington about an info session for the fulbright fellowship. because international relations is my bag, baby. though it did make me feel like a student again, to be getting spam about scholarships.

i am really getting antsy to go back to school. i'm about a fifth (F! I! F! FIF!) of the way through my fun little pretend biology textbook* and have just learned about the krebs (citric acid) cycle and glycolysis. it rings a bell, but seriously, i just don't absorb complex chemical reaction pathways without cute flash animations. i need to find some of those.

*the fun little pretend biology textbook is not really pretend, it's just little. and fun. i ordered it off of amazon because it was written by the prof that i'll theoretically have for bio 180, and it was only 15 bucks, but when it got here i discovered that it was an abridged edition for the university of texas. i got a good laugh out of that, they need abridged textbooks down there in austin, 'cause them t-sips can't read so good. heh. but, abridged or no, it's a good review since it's been 4? years since AP bio and 5 years since AP chem. I FEEL OLD NOW. (Doesn't help that the National Merit Scholarship Program sent me a little form letter saying that they thought I might be graduating this quarter so would I mind filling out a few questions? NO. I'M NOT GRADUATING. THIS IS BECAUSE I AM A DUMBASS WHO CAN'T HACK IT AT STANFORD. Anything else?)

Sigh. I just want to be learning again. The girl at Starbucks asked me the other day if I was taking Biology. I just said yes. I figured the truth was too complicated.

good lazy sunday music: the verve remixed series from itunes. i just downloaded volume 3 and am highly impressed. it's great classic jazz vocalists, remixed by the most talented turntablists around. it's great.

t minus 4 days and counting until the neodandi show. i'm getting progressively more and more stoked. also i am looking forward to it being over so i have my evenings back. but the show is thursday... please come!! you know you wanna. plus, there's an after-hours party at a studio in pioneer square. it's gonna be awesome. friday is SO going to be a sick day.

meh. i learned myself about chemical evolution this past week. i'm reading a bio textbook for the hell of it. now i'm learning about cell structure and the function of various parts of the cell. mostly a review so it's not hard, but there's a lot that i've forgotten that i'd like to remember before jumping headfirst into the bio core.

other cool things from this weekend: pies and pints on 65th. ran around green lake (2.8 miles). go me. we're talking about training for a 5k later this summer. also, cooked dinner with jared tonight. god knows we're terrible about actually doing that. we're trying to get better.

three cheers for this girl

alabama is so backwards. a catholic high school banned a girl from walking at graduation, because she was pregnant. so she walked up to the stage, announced her own name, and walked across. then the cops escorted her mother and aunt out of the church.

oh, and the father of her baby? sure, he was allowed to graduate, no problem.

an open letter to miss tyra banks

Dear Tyra,
Two years ago, you brought forth to our television wasteland the best reality TV show ever created. With a limited casting budget (and indeed a limited production budget) you managed to find a cast of gorgeous, thoughtful, witty, independent women, who only grew more interesting (for better or worse) as the show went on. Every one of them had personality, with the possible exception of Gisele, and we enjoyed watching them argue, pray, suffer, freeze, strut and pose.
With each successive season, the casting budget and audience has grown. Now you have national casting calls, television advertisements, and a much bigger group of girls sending in video tapes and photos. The thing that astounds me is the fact that, with this ever-widening pool to choose from, the cast each season gets markedly worse. Granted, you found a Cover Girl in Eva. She is a dynamic personality that we love to see on TV. We rooted for her from day 1, and she hasn't disappointed. But this season, there was no one with such a dynamic personality - we had boredom, shyness, and arrogance, but not charisma. And there was no mystery about who would win - following the opinion polls from week to week, Naima was a clear front-runner, no matter how much the judges seemed to hate her personality. And so, while watching the finale, when I found myself wondering, "What if Naima DOESN'T win?" I knew that this show had hit rock bottom. Reality TV is not supposed to be predictable and safe. Naima has the personality of a rock. Sure, she's got a mohawk, and I respect that, but honestly, I thought the entire cast of this season sucked ass. Oh, and when you stuck them in front of a teleprompter? That's when I knew this season sucked ass. Not one of them could read! Not one!
So, seriously, Tyra, you need to re-examine your entire casting process. Fire the casting director. Go with the method you used to cast Season 1. Somehow, even though there were only a few thousand applicants, you managed to find a stellar group of people. How is it that with a larger pool to select from, the quality of applicants has gone down the toilet?
Anyway, that's my rant. Tyra, you're disappointing me. Oh, and if you want me for the 6th season, you know where to contact me.
Kat

shameless self-promotion

well folks, it's getting to be that time... the neodandi fashion show performance is next thursday, may 26. i have tickets, so contact me if you want to come. (if you're reading this and you're in seattle, i want to see you there! please?) The tickets are $15 - and if that seems expensive keep in mind that this is at trinity, which is a bit on the posh side, and cover is usually $10 or so. you know you want to come. i have 20 tickets on hand, but i can get more if more people want to come.

i also heard from the designer today that vogue magazine is sending someone out. there are also going to be scads of local newspapers and magazines. it is going to be huge... you know you wanna be there.

ravenna park

more?

evening at the market

there is something magical about the seattle waterfront at dusk. the sound just looks completely surreal when there is so much moisture in the air. i want a condo in belltown with a sound view now.


how can you not want to be here?


kitteh!!!

want more?? check out this set on flickr.

a radical plan

so the pentagon is getting ready to close a bunch of bases. in the name of saving money. by doing this, they estimate they will save 5 billion dollars this year. well, here is my radical plan for saving more than 5 billion dollars this year - in fact, we could save up to 80 billion dollars right off the bat. it's a simple plan, not too difficult to carry out, and it'd make a huge difference in our government's budget. the radical plan?

three words. out. of. iraq. now. (okay. four words.)

sigh. i hate donald rumsfeld.

i've been exploring a lot of productivity helpers recently, to find a method that helps me to get stuff done. i'm not completely sold on getting things done, but it's a start... i'm also exploring backpack, which seems like a neat idea. it syncs with iCal format stuff, too, so i'm thinking about starting to use ical more, especially since you can isync ical with the ipod. i haven't tried the hipster pda really, but it's an idea that i'm toying around with as well. i bought a purse-sized notebook, and it's really handy, but the fact that all the pages are bound together doesn't help with organization.

i guess my main goal for this organizational kick, at work, is to get this job organized and simplified so that when i leave, whoever takes over for me has somewhere to start. god knows they just threw me into the middle of it, and i've had to make sense of it, but i think i'm doing that pretty well, given the circumstances. it's mostly because training the floater has made me realize just what a pain in the ass it is to train someone on a job, and that you'd better be at least a little organized.

and now, for your viewing pleasure: the slacker manifesto. why slackers make the best employees. :D

on another note, izze is the best drink evar.

so long, and thanks for all the fish

friday night we went to the neptune to see the hitchhiker's guide to the galaxy. this movie has been so fucking long in the making it's ridiculous. i remember in 9th grade, a bunch of us including jeff hillary made a promise to all see the movie together, wherever we were and whenever it was. sorry jeff... i didn't make it back. i'm sure you understand. and you still have my fucking stephen hawking book, you bastard, so we're even, really. anyway, as i predicted to tessa as we were walking out of the theater, i have the dolphin's chorus stuck in my head. "so long, so long, so long, so long, so long, so long and thaaaaaaaanks - for all the fish." it was a cute number, and a cute movie as well. there really is too much material in those books to pack into one movie, so that considered, i think they did a good job fitting in all the best jokes and making them make as much sense as possible (very little, really, but that's as douglas adams intended i am sure) in under two hours.

oof.

on second thought, maybe the green isn't so hot. i'll fix that later.

kitty on the potty

and now, frida's bathroom portrait. she's not the most photogenic kitty in the world, so it's tough to get a good shot of her... this is as good as any I've gotten of her.


anyway, it's my bedtime. i'm sick, and i hate being sick because it sucks. and my throat hurts and my head is stuffy and i want to die. :(

tiger!!

another good weekend. friday night we hung out with tessa, and went to the apple store for the tiger release party. it was crowded. and it turns out you can't get the student discount on software in the store, so we didn't buy it there. i ordered it online last week, anyway, and it should be here by friday. Hooray for tiger! i'm such a mac cultie now, it's scary.


This is the crowd in front of the apple store, circa 7pm. Crazy.

anyway, after we left the insanely crowded apple store, we met up with brian and went to chutney's for dinner. chutney's is in wallingford, in the wallingford center shopping center on the corner of 45th and Wallingford.* it is quite possibly almost definitely the best indian food i have ever tasted. plus they have a killer mango margarita. mmm coconut and farmer's cheese curry. :) and it was rad hanging out with tessa - whenever brian and jared started talking about code or servers or networking tessa and i would start talking about shoes. i've needed another female for quite some time.

yesterday was fun as well - we hopped the bus downtown, so jared could buy new shoes at the new balance store. they look like pretty cool shoes, and they're like, real running shoes, too, so they support your foot for walking really well. i'm thinking about going back there next month after i get paid again and buying myself a pair (they make them for women too, and they come in all sorts of awesome colors). i have a rack full of stupid shoes, i need to get me a pair of smart shoes.

Speaking of stupid shoes, I bought a pair of purple ribboned espadrilles at shoes.com. They should be here soon - they shipped on Friday. I'm stoked, they are so cute.

in other news, getting into the class i want this summer is going to be a little iffy. i have to wait for them to mail me my registration info, and then I have to wait until "registration period 3" which i am not sure what that means, because during registration periods one and two, non matriculated students (which would include me, since I havenn't been accepted yet) are not allowed to sign up for the class. i'm really starting to stress about my admissions - when I applied I indicated that i wanted a much more selective major, and often they are less inclined to admit students that might not get into their major. but if i don't get in, i guess i'll just turn around and apply for winter quarter admissions. i'll be like rudy - they have to admit me at some point, right?

we also stopped at american apparel again yesterday. i need to stop going there, because i could really buy the whole goddamn store. (well, except for the shirts in yellow and orange. i can't wear those colors.) I bought a purple and a pink tee, and a blue jersey scarf, and a sustainable edition boybeater. the sustainable edition one is made from 100% certified organically grown cotton. i think that's rad.

i think it's time for us to procure breakfast. jared's been up since 8:30 and still hasn't eaten anything.

* i just used the word "wallingford" three times in a sentence. i miss living there, and every time i go back it's like i'm back home. maybe someday i'll get to move back there - the houses in that neighborhood are nice, and if i ever could afford one that would be sweet.

chocolate, and freezepop, among other things

i just ate roughly 1/6 of the chocolate bar i bought with dinner at the metropolitan market. that is all that i am allowed to eat, since that chocolate bar was not only espresso flavor, but filled with crunchy espresso bean chunks. that chocolate was yummy, but i think it's better breakfast chocolate than after-dinner chocolate. how's that for a great idea - an espresso flavored chocolate bar for breakfast. mmmmm.

so i might be going back to school in june, which is pretty cool. that is, if my boss assents to me taking 2-hour lunches and not working thursday mornings. and if i can get into the class i want. i want to take the first quarter biology class, just to get it out of the way. it doesn't really sound tough, but if I take it in the summer, there's fewer people, so there's less competition to get into the class (which'll make it easier to get it on subsequent quarters as well). it'll be fun. i've been reading about organic chemistry, too, about covalent bonds and hybrid orbitals and Lewis structures. Ah, memories. So when I take O-chem, the first week won't be in a foreign language. After that, all bets are off.

and now, for your listening pleasure: science genius girl, by freezepop! (This song was originally written about me. just kidding. but it's dorky like me.) when i'm in the right mood, freezepop is the best thing in the world. first off, there's plastic stars, the first freezepop song i ever heard, and the second song that Jared ever sent me, right after the postal service's Such Great Heights, so it's an our song, as well. Then there's Science Genius Girl. "I'm the science genius girl/ i won the science fair." You might not know this about me, but I won my school's science fair, went to the regional and state science fairs two years running, and got an honorable mention the second time. that's pretty damn good when you're from TEXAS. So that song speaks to me. Then there's Tenisu No Boifurendo - it's all in japanese. about how you play good tennis, do you want to play tennis with me, i want to be with you. it's adorable. And then there are all of their other songs. Freezepop just plain rocks.

man, talk about a quarter-life crisis. last night, after watching a fascinating episode of the eyes of nye, bill nye (the science guy)'s new show, it dawned on me that what i've been planning on doing with my life is all wrong.

the episode focused on stem-cell research and therapeutic cloning, a subject that i find infinitely fascinating. so it dawned on me, if i'm so into stem cell research, why the hell am i trying to be an art major? i'm not artistic. i'm not even remotely creative. i have an extremely scientific mind, one that has always grasped cellular and biochem processes ridiculously easily. anytime i see anything talking about women in science, and the challenges they face, i feel inherently guilty for not pursuing that path. the only reason i'd never considered a biology major before was because i was afraid of pre-meds. and i've come to the conclusion: fuck the pre-meds. they should be scared of me, not the other way around. i'll ruin their curve. bwahaha.

so, i'm thinking that i'm going to major in biology, with a concentration on molecular, cellular and developmental bio. i've been reading course descriptions and major requirements, and nothing looks too scary, or too hard. i can do this... it's what makes sense to me. and then, i'll do mad research, and get a killer position with a biotech firm, and make bank. and then i'll buy all that awesome furniture i wanted in the first place.

the kitties, about half an hour ago. it is an absolutely gorgeous day here - 70 degrees and sunny. it's really starting to sink in that winter is gone, and it's going to be warm for awhile. my plan of action for surviving the summer? american apparel skirts and a great pair of espadrilles. i'm still searching for the espadrilles - i haven't seen anything i like in my price range yet. but the quest will continue until i am espadrilled.

more kitties. sorry they're blurry, but i couldn't get another shot at this one, since the kitties dispersed shortly thereafter.

so today i had a fitting for the neodandi show, down under the viaduct in pioneer square, at lunchtime. so i kinda got sidetracked and wandered a bit, and snapped a few shots. i'm slowly getting the hang of this, at least enough to wish i had a nicer camera. someday.


shooting from the hip. plus, my screen suxors during the day, you can't see it for shit.
i've noticed that i tend to take pictures of everything, rather than of something. i need to work on this.

So yesterday was Free Scoop Day at Ben and Jerry's. This is an annual event equivalent to the Islamic pilgrimage to Mecca - the Ice Cream Hajj. OK, so not QUITE as important, but close. Anyway, I got there somewhere around 7 and the line was already to the Ann Taylor store.

It took almost an hour for me to get my free ice cream, but it was well worth it. My iPod had enough juice to keep me rockin' out the whole time (yes, even being that weird girl who dances to her headphones at times), which enabled me to tune out the vapid conversations happening around me and absorb myself in people-watching. Jamie, if you're reading this, I saw your fucking clone there - from 4 years ago. This girl looked EXACTLY like an 18 year old Jamie, complete with big backpack, bike helmet, and stainless steel commuter's mug. She was even Jamie's height and looked like she might even be Lebanese. It was kind of creepy, but it made me all nostalgic.

I didn't take a picture of the ice cream I finally got for free, but I got a sugar cone of triple caramel chunk, which is an absolutely awesome flavor. Yum.

It's hard to believe it's already april. the cherry blossoms are almost gone because it's been rainy and windy for the last week, but today it's bright and sunny. for some unknown reason, my body decided to wake up at 9:30 (oh wait, that was Jared, who started jabbering at the kitties) and I gave up on falling back asleep. i walked up to the honey bear bakery (which is inside the Third Place books on 20th and 65th in Ravenna) for breakfast for Jared and I and obtained a pair of these delicious cinnamon rolls with cream cheese and raspberries on top. Delectable. On the way home I took a shortcut through Ravenna Park, which is absolutely beautiful right after it rains. I don't know why it didn't occur to me to take my camera out and snap a picture. Next time. I need to work on this photography habit.

After that wonderful breakfast, Jared and I took the bus up to the Ave and visited american apparel. this store seriously kicks ass. they have just about any article of clothing imaginable, in a really soft cotton knit, in seventeen different colors. pink, yellow, red, lavendar, teal, turquoise, blue, black, brown, gray. t-shirts, long-sleeve tees, tanks, skirts, exercise clothes, legwarmers, scarves. it's like this great big house of basics, that you can layer on to be bright and cheerful. and it's all 100% sweatshop free, made in downtown LA. the workers all get full benefits and the best wages in the industry. they even have an organic cotton line and are working on integrating the organic line into the rest of their clothes. it's so fuckin socially conscious, it's great. so i am comfy and guilt free! plus their shirts just look hot on me.

i'm hungry.

The following is a communique from a group calling themselves Unitarian Jihad. I found it here and I felt the need to reprint it in this space. Beware! Unitarian Jihad is upon us.

"Greetings to the Imprisoned Citizens of the United States. We are Unitarian Jihad. There is only God, unless there is more than one God. The vote of our God subcommittee is 10-8 in favor of one God, with two abstentions. Brother Flaming Sword of Moderation noted the possibility of there being no God at all, and his objection was noted with love by the secretary.

"Greetings to the Imprisoned Citizens of the United States! Too long has your attention been waylaid by the bright baubles of extremist thought. Too long have fundamentalist yahoos of all religions (except Buddhism -- 14-5 vote, no abstentions, fundamentalism subcommittee) made your head hurt. Too long have you been buffeted by angry people who think that God talks to them. You have a right to your moderation! You have the power to be calm! We will use the IED of truth to explode the SUV of dogmatic expression!

"People of the United States, why is everyone yelling at you??? Whatever happened to ... you know, everything? Why is the news dominated by nutballs saying that the Ten Commandments have to be tattooed inside the eyelids of every American, or that Allah has told them to kill Americans in order to rid the world of Satan, or that Yahweh has instructed them to go live wherever they feel like, or that Shiva thinks bombing mosques is a great idea? Sister Immaculate Dagger of Peace notes for the record that we mean no disrespect to Jews, Muslims, Christians or Hindus. Referred back to the committee of the whole for further discussion.

"We are Unitarian Jihad. We are everywhere. We have not been born again, nor have we sworn a blood oath. We do not think that God cares what we read, what we eat or whom we sleep with. Brother Neutron Bomb of Serenity notes for the record that he does not have a moral code but is nevertheless a good person, and Unexalted Leader Garrote of Forgiveness stipulates that Brother Neutron Bomb of Serenity is a good person, and this is to be reflected in the minutes.

"Beware! Unless you people shut up and begin acting like grown-ups with brains enough to understand the difference between political belief and personal faith, the Unitarian Jihad will begin a series of terrorist-like actions. We will take over television studios, kidnap so-called commentators and broadcast calm, well-reasoned discussions of the issues of the day. We will not try for "balance" by hiring fruitcakes; we will try for balance by hiring non-ideologues who have carefully thought through the issues.

"We are Unitarian Jihad. We will appear in public places and require people to shake hands with each other. (Sister Hand Grenade of Love suggested that we institute a terror regime of mandatory hugging, but her motion was not formally introduced because of lack of a quorum.) We will require all lobbyists, spokesmen and campaign managers to dress like trout in public. Televangelists will be forced to take jobs as Xerox repair specialists. Demagogues of all stripes will be required to read Proust out loud in prisons.

"We are Unitarian Jihad, and our motto is: "Sincerity is not enough." We have heard from enough sincere people to last a lifetime already. Just because you believe it's true doesn't make it true. Just because your motives are pure doesn't mean you are not doing harm. Get a dog, or comfort someone in a nursing home, or just feed the birds in the park. Play basketball. Lighten up. The world is not out to get you, except in the sense that the world is out to get everyone.

"Brother Gatling Gun of Patience notes that he's pretty sure the world is out to get him because everyone laughs when he says he is a Unitarian. There were murmurs of assent around the room, and someone suggested that we buy some Congress members and really stick it to the Baptists. But this was deemed against Revolutionary Principles, and Brother Gatling Gun of Patience was remanded to the Sunday Flowers and Banners committee.

"People of the United States! We are Unitarian Jihad! We can strike without warning. Pockets of reasonableness and harmony will appear as if from nowhere! Nice people will run the government again! There will be coffee and cookies in the Gandhi Room after the revolution."

Sweet.

i think i'm trying to be artistic with some of these. this is fun, this concept of making images with an electronic box. perhaps i could like this.

frida and a door.


maxwell and a bathtub.


agent scully the second. or, something else, if you can come up with a better name.

i'm going to start carrying my camera around with me in my purse, so expect more photos. in fact, i should post a picture of my purse, because it is rad. i'll do that later.