liek woah.
what the frack?
why did i just say frack?
i just finished up season 2 of BSG. um... what? what the frack do those cylons think they're doing? how will i survive the Galactica-free months to come? and will i actually start watching this show on fracking friday nights, when it's on? sigh.
4.02.2006
3.31.2006
today has been one of the best days i've had in awhile. which isn't to say that the last few days haven't been great, because they have. i don't know what's going on, but i've been riding a high for the last 2 or 3 weeks. a lot of it is probably spring. tomorrow is finally april, which means we've hopefully said goodbye to low 40's and rainy. it's been a dreary winter.
but the last few weeks, i've just been feeling better and better about my life, and the way things have gone recently. i'm enjoying the freedom that i have now. i need a stick to (selectively) fend off the boys. academically, things haven't been this good since high school. and i'm doing original research. today i figured out something that no one has ever known before.
let me repeat that. today i figured out something that no one has ever known before. how fucking sweet is that? it was all me. brock helped, but it was my pcr, my gel, my dilutions, my dna pools, my pipetting, my labeling, my eye that spotted the missing band in the mutant fish.
i think i'm going to name it pinball wizard.
posted by
Kat Reinhart
at
19:21
3
comments
3.28.2006
the answer to life, the universe, and everything... turns out to be the number 42.
posted by
Kat Reinhart
at
09:05
0
comments
3.23.2006
3.22.2006
for some unknown and ungodly reason, i've been up for an hour. what? when do i wake up, ready to go, at 5:30 AM?
i've been reading metafilter and dailykos, which i don't read very often, but they do seem to be a trend indicator of the "netroots". which is where our next political movement needs to come from. they seem to be big supporters of feingold, which i think i can get behind.
the crucial moment though, will be midterm elections in november.
posted by
Kat Reinhart
at
06:52
0
comments
3.21.2006
3.20.2006
9 hours
1 pitcher of beer
2 coffees
1 art gallery
one game of scrabble in gasworks park
1 6-pack of beer
several good pictures
one good sunday
posted by
Kat Reinhart
at
00:06
0
comments
3.18.2006
3.14.2006
because my water tastes better than the water in the dish over there.
posted by
Kat Reinhart
at
19:42
0
comments
end of quarter what?
finals week is always so disorienting. no classes, but it's not really spring break. i ought to be studying. so i just replaced the battery on my ipod. after having had the replacement battery for almost a month and trying repeatedly and unsuccessfully to dissect the damn thing, i finally figured it out. you just gotta jam a tiny screwdriver or three in between the metal and plastic casing, prying the metal outward and off. connecting the battery took a little fumbling, but i managed to cram the new, slightly larger battery with its slightly longer cable into the case no problem. i was particularly impressed with the hard drive, though - it's like the size of a credit card! but anyway, that's done, and now my ipod is charging, and it will play for 18 hours. and life will be good.
i think i have a plan for my little sunroom. i'm going to build a false floor with some plywood and cinder blocks (or something like that) and put in a bamboo mat. ideally i want a tatami-like thing, but i looked at those online and they are hella expensive. i'm thinking bamboo beach mats or something. that way my kitty won't be able to escape from that room, and i can leave the inside door open when it's hot and sunny. i need to do something about the mold, though. damn mold, ruining everything.
posted by
Kat Reinhart
at
09:20
1 comments
3.06.2006
"...we tend to easily blame others for our suffering, and we can justify it because maybe other people are mistreating us or exploiting us or don’t understand us or are doing dreadful things to us. We’re not denying that, but we make nothing of it any more. We forgive, we let go of those memories, because taking refuge in Sangha means, here and now, doing good and refraining from doing evil with bodily action and speech."
from. Long, but worth a read.
posted by
Kat Reinhart
at
21:13
0
comments
3.02.2006
it seems like things are mellowing out, which is nice. classes are winding down. all i have to do for 355 is finish up our project and present it. and that is well under way. after that, it's just 2 finals - chem and bio 220. both of which i intend to ace. or at least come close.
we get to use a note card in chem. i mean, come on. i've had trouble with this feature in the past, since i tend to scribble out my notecard the day of or night before and never know what to put on it, but this time i'll plan it out and get it just right and be able to totally pwn that test.
and on bio i will actually READ the questions and the answers carefully. i hate it when i make stupid mistakes. someone got a perfect score on the last bio exam and i hate them, i will hunt them down and make them give me their grade. or something.
hopefully my gpa won't take too much of a hit.
this weekend: moving! whee!
posted by
Kat Reinhart
at
21:52
3
comments
2.28.2006
time to vote.
exhibit (a):
exhibit (b):
so which should i do with my hair?
posted by
Kat Reinhart
at
09:45
3
comments
2.27.2006
week 9 already. what?
and a tickle in the back of my throat reminds me of the chorus of hacking coughs that accompanied the lecture this morning in bio 355. suzie gave me some "airborne" which is supposed to be one of those supplements that helps ward off colds. i'm hoping it does its job, because week 9 of the quarter is a shitty-ass time to get sick.
i'm getting really fucking sick of my classes this quarter, too. bio 220 ceased to be interesting and started being just boring when we switched from animals to plants. oooh, plants photosynthesize. no fucking way. i dunno. i'm not a plant person. o-chem is still marginally interesting, which will cease next quarter because the guy who barely speaks english and had a stroke last year is my new professor. he's easy, but you don't learn, is what i've heard. and today we had our last real lecture in bio 355 - wednesday is a quiz, and next monday and wednesday are the expo for our projects. it'll be nice to have that class totally out of the way, though i think i blew my chance for a 4.0 with that last quiz and discussion paper. but then again everyone did bad on those and so maybe i was still ahead of the curve. who knows.
ochem test and bio quiz on wednesday. bio presentation next wednesday. two finals two thursdays from now, and it's all over.
at least we're studying stereochem in ochem right now. that's one of those things that either you get it or you don't, and i get it. i can rotate 3-dimensional objects in my brain and distinguish between stereoisomers pretty damn easily. i'm hoping this helps me dominate the next test like i did the last.
aside from school, my project for this week is to paint my new room in my new house. and then move in. and hopefully my new housemates were not hiding psychopathologicalities. i just made that word up.
posted by
Kat Reinhart
at
20:37
0
comments
2.23.2006
i saw bill gates last night at bis on main in bellevue. paul allen was with him too, as were 3 other unidentified but undoubtably stinking rich dudes. my grandma sure does know how to pick a good restaurant.
posted by
Kat Reinhart
at
15:35
2
comments
2.20.2006
"He hates his children, he treats his wife like dirt, he gets high all day."
kevin federline is the most pathetic excuse for a famous person ever. at least paris hilton looks cute (/slutty) on camera and has a bunch of money. K-fed is just a stupid lazy mooch who doesn't shower. Eugh.
craigslist is down. this is annoying.
posted by
Kat Reinhart
at
11:27
0
comments
2.16.2006
so i started watching grey's anatomy tonight, at the suggestion of several of my friends in bio... fuck me, this show is awesome. it almost makes me want to go to med school though... actually a lot of things have been making me want to go to med school recently. i know, how fucking weird is that. i have NEVER wanted to be a doctor, ever. but the last year or so it's been one of those recurring random ideas. i don't know if i can do it, if i'm capable of it, but i think that i could give it a shot, right?
and i know it's nothing like it seems on tv. if it were like it is on tv i'm not sure if i would want to do it. man, that show makes seattle seem like a fucked-up town. and what the fuck is wiht having the hospital right at the base of the space needle? and the aerial shots "look, we're in seattle! hey guys, this show is set in seattle! did you notice the space needle there? this is seattle!" bah. there's no hospital in seattle center.
evidently the northwest has dire need for pediatric neurologists.
posted by
Kat Reinhart
at
23:36
1 comments
2.15.2006
OK, so I guess yesterday wasn't a complete waste. between a few well-timed myspace messages to and from semi-random people (I guess everyone else gets lonely too) and some much-needed chocolate from brian, i went to bed a lot happier than i started out.
I still haven't got my fucking paper review that's due tomorrow done... gah, this thing is kicking my ass. I keep writing and writing and then I realize that I'm only half done and it is 550 words and the word limit is 500 and I don't know how to cut it down! fuck! i am tempted to just leave it until tomorrow afternoon, but i know that's a bad idea since i only have an hour to take care of stuff before it's due. fuck. fuck fuck. i haven't had this much trouble with one of these reviews yet, but this one is by far the most info-dense paper we've had to read (no one else i've talked to even read the paper, much less *understood* the damn thing) and we're supposed to summarize and critique in 500 words or less. Fuck.
In other news, I'm going to look at an apartment/meet a possible roommate on saturday. I would rather find my own place, but I figure it's worth a shot to see if we get along, since $400 is cheaper than $535 and my parents can only give me $750 a month, total, and i have bills and bills and i have to eat, you know, small stuff. blegh, why is life so stressful right now??
posted by
Kat Reinhart
at
23:20
0
comments
2.14.2006
today is the worst day of the year. it's like a day for everyone to say, ha ha, kat, you can't manage to keep a man happy, instead they all fall in love with your prettier friends and ditch you, leaving you with nobody when you need somebody. i started crying on the way home from the bus. valentines day is the stupidest, shittiest holiday in the world and i hate it.
and now, just in case this might be pertinent to anyone reading this: 10 reasons why you should never accept a diamond from anybody.
posted by
Kat Reinhart
at
17:00
0
comments
2.12.2006
blaaaaah.
i've gotten up earlier both days this weekend than i did at all last week. saturday i had a volunteer orientation at the seattle aquarium, which was pretty cool. it's a bit of a time commitment but it should be fun... talking to kids about sea urchins and stuff. plus once you've put in 100 hours then you can move into the more behind-the-scenes stuff like animal husbandry or diving (if you're certified, which i'm not, but maybe someday!) so i'm pretty stoked about that
and then today i hit the slopes like a madwoman. i took the huski bus to stevens pass, which i'd never been to before, but it was pretty sweet. stevens is not a beginners mountain, and there's exactly 1 green run on the whole thing, but i didn't even start on the green, i started on the blues and was kicking some butt the whole time! go me. i was linking turns and going onto my toe edge even on the steepest parts, bombing down the slopes. it was rad. also i got to go in the singles line, which made lifts way faster. and also since it isn't a beginners mountain, there were very few snowboarders sitting on their butts on the slopes clogging it up for the rest of us. in fact parts of it were quite empty and the snow was beautiful and the weather was awesome but i am sunburned.
posted by
Kat Reinhart
at
20:08
0
comments
2.11.2006
i'm thinking about going blonde again. i'm getting kind of sick of the redhead thing.
on another note, trying to find an apartment fucking sucks. i waited outside this one place for 20 minutes today waiting for the manager to show... only to find out that they didn't have keys to the unit they wanted to show. also, the place was way the fuck out there, by magnuson park, not in walking distance of anything to speak of. *shrug* a bunch of new places have come onto craigslist in the past few days though, so hopefully i'll be able to find a box or maybe even an apartment with a bedroom that i can call home.
living on my own should be interesting.
posted by
Kat Reinhart
at
17:45
0
comments
2.09.2006
let's just say i've learned a lot recently about who my real friends are and who i can trust.
posted by
Kat Reinhart
at
08:08
0
comments
2.08.2006
i am officially addicted to battlestar galactica. it is the most awesome show ever.
posted by
Kat Reinhart
at
17:21
3
comments
2.07.2006
you'll be loved, you'll be loved
like you never have known
and the memories of me
will seem more like bad dreams
just a series of blurs
like i never occurred
someday you will be loved
death cab for cutie, "someday you will be loved", plans
posted by
Kat Reinhart
at
09:38
0
comments
2.06.2006
i'm tired and i'm lonely. being alone is hard on me, it's never been my strong suit. at least i have frida, and for the moment i have suzie and zoe, but at the end of the day, i'm the only one in my bed and that's tough for me to deal with. i'm having a hard time telling if i'm depressed or not, too. i know i was last week and the week before that, but now that the sun's out things are a little better. though things are at the same time not better at all.
i know that time will help, but right now i just really wish i had someone to hold me.
posted by
Kat Reinhart
at
22:25
5
comments
2.05.2006
my head is full of tons of thoughts that just can't seem to come unclogged. i guess it's to be expected. it also dawned on me that if you look back on the archives of this blog, the times you'll see the most entries, and certainly the most real content, are while i'm not currently in a relationship. i think that i start self-censoring at some point. but anyway, i don't need to censor myself now.
or maybe i do. there's still so much that i haven't sorted out for myself, so much that i don't want to talk or think about for awhile. i've wrapped my brain around some very difficult concepts the past few days, concepts that i've been denying for awhile. being in a relationship does change you in some ways, makes you less fundamentally "you". for so long i've been jared's other half, part one of two, what have you, that i feel i really need time to discover the rest of me. like what i do when i live alone. i mean really alone, not in my own room in a dorm.
i think it could be interesting.
i also really, really want one of these.
posted by
Kat Reinhart
at
22:21
0
comments
2.04.2006
apologies for the last post. if anyone actually reads this anymore.
anyway, in case you weren't in the loop, it's been a rough fucking week. i swear, it's the weather. we haven't seen the sun in like 3 and a half months. we're probably vitamin D deficient or something, but we are all going nuts up yonder in seattle. i think i've been depressed for awhile now, and i know jared has. and we've finally decided on some things that are going to make things better.
first of all... i've realized that i need to be out on my own. i have never lived by myself; i've always relied on someone else to share in the duties of keeping a living space. i think it's high time i try that out, even if it's only a box with a kitchen at one end.
second, i've realized how important to me school is. it's a goal i feel i lost sight of a long time ago... probably somewhere about halfway through my senior year of high school, looking back... but i really am loving what i'm doing now (in a way that i haven't felt since i was back in mccormick's AP chem and bio classes), and i'm pretty damn sure that it's what i want to do. i also have decided that while i'm where i'm at, i'll be able to do what i want to do living alone better than i would living with jared.
and then, as weird as it sounds, i think that the way that jared and i have felt about each other has been slowly changing, even though we might not have been completely aware of it as it was happening. and it's probably not something i need to go into detail about, because these things will sort themselves out in the end. but let it be said that i'm moving out, and moving on, but i know i have friends no matter what, and that's what matters.
plus, i want to marry john dorian.
posted by
Kat Reinhart
at
23:41
1 comments
2.01.2006
1.11.2006
1.06.2006
1.02.2006
newy hap year!
ok, so it's been awhile since i've posted. too long, i guess. whatever.
it's 2006. WHAT. THE. FUCK. no one asked me if it was okay to become 2006, nor did i ever give my consent. the other day, jared accidentally wrote 12/27/01 on a check, and i laughed at him. on the bright side, this means we're... a quarter of the way through the last ever Bush presidency (knock on wood)... and more than halfway done with the first decade of the 21st century (and third millennium).
let's see. since i last blogged, i finished finals (4.0 GPA baby), got an X-mas tree went to Whistler BC with Jared for 4 days, and spent a lot of time with family for the whole X-mas thing.
Here's the tree, in all its beauty and resplendency:
i'm taking it down today (all the ornaments and lights are down now) which is sad, since it was such an awesome tree. oh well... hopefully next year we can find just as great a tree. (super shout out to Tessa's dad for the tree!)
o canada!
whistler was sunny and 31 (okay, -0.5C, since we were in Metric-land) the whole time we were there, leading to icy snow and a somewhat less than optimal boarding experience. no new snow the entire time we were there, until the morning of our departure the clouds rolled in, and by the time we were 15 minutes out of whistler, it looked like this:
we even saw a car overturned in a ditch. scary stuff, but i think everyone was out of the car by the time we drove by. no one seemed terribly injured, which is always good. and we made it safely home.
the whole trip was a ton of fun though, since when we weren't snowboarding, we were drinking, or sleeping, or watching ski and snowboard instructors jump through rings of fire:
posted by
Kat Reinhart
at
15:26
0
comments
12.14.2005
12.09.2005
i hate the president
Via salon (reg req'd, or watch an ad):
Mike Wallace on what questions he'd ask George W. Bush -- who has declined to be interviewed by Wallace -- if he were given the chance: "What in the world prepared you to be the commander in chief of the largest superpower in the world? … You apparently were incurious. You didn't want to travel. You knew very little about the military … Do you think that has anything to do with the fact that the country is so [bleeped] up?"
Also, everyone should read this.
posted by
Kat Reinhart
at
09:44
1 comments
12.01.2005
OMG SNOW!!!111!1
nothing sticking at this point, but it's only noon and the forecast is that it's going to keep snowing until 10pm tonight. woohoo!!!
posted by
Kat Reinhart
at
12:06
1 comments
11.21.2005
edward update!
he continues to show an uncanny ability to locate the "different" or "new" thing. here, he has located my sociology textbook.
he looks ginormous in this picture. wait, he is ginormous.
posted by
Kat Reinhart
at
21:44
0
comments
11.18.2005
arctic monkeys
via salon... these cute little british boys are renewing my faith in rock music.
posted by
Kat Reinhart
at
17:52
0
comments
11.15.2005
11.14.2005
11.12.2005
snow on baker.
this is what winter is all about.
12" of fresh powder, and it's not even November 15. This ALMOST makes up for last season. Almost.
ninja!
posted by
Kat Reinhart
at
18:06
1 comments
11.11.2005
bwahahaha
“Chillemi said that in choosing who to hire, ‘If it came down between a man or a woman, of course I’d pick the man. The woman would most likely get pregnant and leave’,”
Fox News Sued for Sex Discrimination
posted by
Kat Reinhart
at
12:31
0
comments
11.10.2005
talented kitty
this is edward. he has an uncanny knack for finding things on the couch which are not the same as the couch, and showing you these items by sitting on them. here, edward demonstrates his ability to locate my bio lab notebook.
what an amazing kitty.
update:
look, he found my vest.
posted by
Kat Reinhart
at
16:36
5
comments
10.23.2005
10.21.2005
bush meets bono
salon has a totally great picture of the president with his arch-nemesis, bono... with some really funny captions. The picture itself is worth a thousand words... you can just SEE the hate-rays coming out of bono's eyes. i guess that's why he wears those sunglasses, because otherwise the president's head would just *bam*
posted by
Kat Reinhart
at
09:38
0
comments
10.19.2005
swish
so i aced the second bio quiz. and all is right with the world. exam on friday? no fuckin problem.
i'm all doped up on day-quil, so my brain's been a bit slow today. what follows is a complete non-sequitur. i had lab this morning. my lab group already absolutely loves me because i save their ass a lot. or just save them a lot of work. one or the other. i can't help it, molecular biology just makes sense to me.
the days are getting shorter and darker and I LOVE IT. i'm so excited for winter. too long has my snowboard languished under the bed in disuse. plus i got new boots (that actually fit) and real metal bindings (rather than plastic) last season so i'm good to go. i just hope we don't have another stupid global warming winter like we had last year.
posted by
Kat Reinhart
at
14:53
0
comments
10.10.2005
grrrrrrr
oh my fucking god i am so pissed off at my bio ta. so on the first quiz, which was returned to us today, i got a fucking 19 out of 20. so i look to see what i'd done wrong because I KNEW i had aced that quiz. and I see that i've been docked a point because the o and the l in the word "Golgi apparatus" are a little close together so it looks like I wrote "Gdgi apparatus". OH. MY. FUCKING. GOD. YES I REALLY THINK IT'S CALLED THE GDGI APPARATUS. WTF.
I shouldn't be seething about 1 point on a quiz, BUT I AM.
posted by
Kat Reinhart
at
13:51
2
comments
10.07.2005
before i die i will do this
dogsledding on svalbard
i was just playing with google maps, when i found this island north of russia and norway, about on the same latitude as the north end of greenland, and i was like, hmm, what is this place? so i wikied it. it looks beautiful. so i randomly found this site for this "resort" type place, where you can stay in longyearbyen, which is the "major city" on the island (pop. less than 2000) and take a 3-day dogsledding adventure to a ship frozen in a fjord. where they have modern amenities and a cozy little hotel. it just sounds so fucking cool... plus you get to pick your own puppies and take care of them for the duration of the trip!! puppies! just waiting, hoping you'll let them go on a trip running with their buddies across the arctic. and the only sound you can hear is the doggies running on the snow. i must do this before i depart this earth.
posted by
Kat Reinhart
at
17:28
5
comments
10.03.2005
liek omg
the best thing evar happened before biology lecture today... a girl got up to make announcements about tri-beta, the biological honor society, and their goings-on. so she gets up and giggles and tells us about tutoring, and omg, like mentoring and stuff, and then the biology club meetings, the first of which is this thursday at 6pm, where we'll be talking about, um, intellectual design, so you should all like, totally come!
biology honor society my ass. intellectual design, omg! u r so smart. i wonder if she was just ditzy because she was in front of 200 people, or if she really has no perspective on what intelligent design is.
posted by
Kat Reinhart
at
18:21
0
comments
9.30.2005
blogging from the starbucks on the ave. funny thing is, within the walls of starbucks, there are 3 available wireless networks, only one of which is starbucks' t-mobile proprietary pay network. so i'm sticking it to the man, and to everyone who thinks you should pay for wi-fi.
just got out of my first sociology section. everyone was really quiet. i hate sections like that, where no one ever says anything... maybe it'll get better as the quarter goes on. there's a girl in there who's a new orleans "displacee" (is that better than refugee?) and we talked for a few minutes about the hurricane and how it caused a diaspora... and the TA said "hundreds, thousands of people... maybe even tens of thousands." try again, blondie, it was hundreds OF thousands.
yeah, my TA in that class is this 5'9 perfectly groomed blonde princeton grad with a ginormous diamond on her left hand. how fucking typical.
bio lecture in an hour... i'll finish my coffee here and then get some teriyaki across the street. mmmm, teriyaki. and then it'll be time for class. whee!
posted by
Kat Reinhart
at
11:24
1 comments
9.27.2005
the sounds of hell/school starts tomorrow
there's been the sound of someone playing a recorder very poorly floating through our apartment since i woke up at around 8. i'm guessing this is the doing of a third-grader, because i remember last time i was at my aunt and cousins' house, my little cousin zoe had a recorder and played it poorly. it's one of those things that you do in third grade. but why, for the love of god, has this horrid noise been going on for the last two hours??? it's pretty clear that the person playing the recorder knows no more than two notes, three if you count that god awful sound that a recorder makes if you just blow harder. if i were wearing pants, i might go investigate, and possibly throttle the little bastard. alas, i am pantless.
on another note, i think i'm really going to like this whole not-working thing. i didn't get out of bed until 9:30. my class schedule won't allow me to sleep in that late most days, but for one day it was really nice.
speaking of class schedules:
monday: bio 200 lecture, 12:30-1:20
tuesday: soc 212 lecture, 9:30-11:20, bio 200 lecture, 12:30-1:20, near e 210 lecture, 2:30-4:20, swim conditioning, 6:00-7:00
wednesday: bio 200 lab, 9:00-11:50, bio 200 lecture, 12:30-1:20
thursday: soc 212 lecture, 9:30-11:20, near e 210 lecture, 2:30-4:20, swim conditioning, 6:00-7:00
friday: soc 212 quiz, 10:30-11:20, bio 200 lecture, 12:30-11:20, near e 210 quiz, 2:30-3:20
soc 212 is "evolution and revolution: an introduction to comparative social change".
near e 210 is "introduction to islamic civilization".
bio 200 is intro biology. durrr
posted by
Kat Reinhart
at
10:17
2
comments
9.24.2005
9.22.2005
9.19.2005
avast, ye landlubbers. it be talk like a pirate day. ahoy, yarr, all that good stuff.
so thus begins my last full week of work. classes start next wednesday, the 28th, so i'm calling it quits after this week. well, i'll be coming in on mondays to help out with training and such for a few weeks, but it's not full-time so it doesn't really count.
today at work i laid out my 4 year plan - which turns out to only be a 2 year plan. it seems that i can get all the coursework i need into 7 quarters - so i'll take 10 units next summer, and a full-time load every other quarter - and graduate next winter or spring. well, get my undergrad degree then, as i fully intend to pursue More of the Same and then Pile it Higher and Deeper after i complete my B.S. degree.
edward is obnoxious; i have laundry; i think we're having tortelloni for dinner. not to be confused with tortellini. duh.
posted by
Kat Reinhart
at
18:08
0
comments
9.15.2005
9.13.2005
fuzzy trees
been awhile. bad blogger.
had a good camping trip this weekend, one in which i got to cuddle with tessa and we saw lots of big trees. no one else would have noticed these big trees if i hadn't pointed them out, see, look there's a big tree. it's helpful to have a biology major along for these kinds of things.
better than big trees, however, were the fuzzy trees.
we went over to the olympic national park, up the elhwa river valley. it's not quite rainforest over there, but we were certainly in a forest, and it did rain a bit. just a bit, one night.
we hiked something like 6 miles on saturday, and boy was that a pain in the ass. we're going to have to get our stamina up before we can do that epic hike i keep talking about. i want to hike up the hoh river valley, all the way up to the glaciers at the base of mount olympus. one day, i want to climb mount olympus. it's only like 8000 feet.
this lake is going away soon. the dam holding it back was built in 1913 and frankly, it looks like it might be time for it to go away. the dam is all cracked and dilapidated-looking. we met an old couple at the lake overlook and they seemed pissed about the idea of taking down the dam. i say, we got a bit overzealous with our whole nature control back when the army corps of engineers was new and mother nature won't put up with our shit forever. so it's better to take down the dam in a controlled way than wait for it to go boom and send huge blocks of concrete down the valley at a hundred miles an hour.
tomorrow is haircut day. stay posted.
posted by
Kat Reinhart
at
17:41
2
comments
8.31.2005
i've been pretty pensive recently. mostly because of hurricane katrina, i think. it's weird. i lived outside of NO in '92 - which if you know your hurricane history was the year andrew struck - and i remember it being a pretty wild ride, though it was only a TS when it hit louisiana, not the cat5 hurricane it had been thru florida. but still, having lived there for 2 and almost a half years during my childhood i know the lay of the land, i have many memories of that city and its amazing waterfront aquarium and the french quarter and the superdome and my dad's office off poydras. and now that is all under 15 feet of water and it just seems surreal.
the thing that makes me so mad is the revelation that the feds have red-lighted several projects to improve levees and shifted their focus away from hurricane preparedness. it's all a part of the integration of FEMA into the department of homeland security. and the shifting of all "available" funds to the iraq war. it's absolute, utter bullshit.
posted by
Kat Reinhart
at
17:56
0
comments
8.28.2005
not a lot to write about recently, so i haven't. it's been a boring week. i had a fucking cold this week, it was lame. and i'm still hacking up wads of phlegm. earlier today a phlegmwad shot out of my mouth and landed on the couch. i'm sure you wanted to know that.
meh. still no update from school, except i got my transfer credits evaluated (but not for ger's) and i'm officially a resident it seems. not that there was much question about it, i live here.
bleh.
posted by
Kat Reinhart
at
14:06
2
comments
8.19.2005
8.18.2005
dept. of stupidity
man, i really hate bureaucratic crap. since i didn't get admitted the first time around, i was delayed by a month in signing up for my stupid summer orientation and registration day, and the next available one for my major is on september 7. that's 3 weeks before classes start. so basically, i can't count on getting the classes i want or need, since they're all already full. if i could register now, i could lurk on the registration page, waiting for someone to drop (or get dropped). but now, even if spots in either of the crucial classes i need open up, i still can't register. this really, really makes me mad. i'm probably going to end up taking a whole lot of bullshit fall quarter if i don't have incredible luck.
i just talked to my boss, too. they are really upset that i'm leaving, but they won't let me stay on in the same position part-time. which sucks. they offered me a part-time mailroom position, but to that i say FUCK NO. been there, done that, won't go near that again. hopefully the office of financial aid will come through saying i'm eligible for work-study soon, so i can pursue one of a few work-study jobs that look cool (most of them involve washing glassware and preparing specimens; one of them involves caring for zebrafish. i'm hoping to get that one). unfortunately, work-study jobs are generally 10-15 hours a week and pay about $10 an hour. which means i'd be bringing home somewhere in the neighborhood of $400-500 a month. which is entirely unacceptable unless i get additional financial aid offsetting my housing costs. bleh. so much rides on the anonymous decisions of faceless bureaucraps right now.
posted by
Kat Reinhart
at
15:58
2
comments
8.15.2005
8.14.2005
8.13.2005
the ballard beach at sunset on a friday is a happening place.
posted by
Kat Reinhart
at
21:08
0
comments
soybeans and boobies
the great thing about saturdays is that i don't have to get dressed until i want to. i just rolled out of bed (remarkably hungover; i didn't think i had THAT much to drink last night! oh well, it was all free (thanks ross/jason!) so i suppose it's all good) and am now eating tofutti for breakfast, wearing nothing but underwear. i love being a grown-up sometimes.
oh, and for the record: tofutti is a perfectly acceptable ice cream substitute. the texture's a little different - smoother, harder - but it's so creamy and yummy and delicious, and it doesn't give me lactose issues. hooray.
incidentally, i've been boosting my soy/tofu intake, because soy products contain phytoestrogens and are supposed to make your boobs bigger. i'm only on day 5 or 6 of this experiment and i can definitely see results. i should market my diet.
posted by
Kat Reinhart
at
09:48
7
comments
8.11.2005
that's right, motherfuckers
if anyone was wondering how to get into the university of washington, here's my advice: when you petition your rejection, tell the admissions people that they are killing small children by not admitting you to the u. it works, really. though i suppose it's less of a stretch for someone who wants to study developmental biology and genetics than it would be for, say, an english major... but details.
suddenly i'm actually proud of myself for getting into college. this was never supposed to be hard. gah.
posted by
Kat Reinhart
at
21:35
2
comments
8.03.2005
i will post this on craigslist so god help me
kitten for sale. $5.
ok, not much of a kitten, he's about a year old, black, real purty kitty. not too bright, but he loves to play. went fucking psycho tonight and catapulted (ha ha) himself around the house, peeing on the furniture. yes peeing. maybe spraying. whatever it was it was yellow and smelled of cat. i thought at first that it might be an earthquake - shit was rattling, then it turned into thumps, and crashes, and scrapes, and mrrrrroooowwws, until he must have pissed himself dry. he's been real docile ever since, all cuddly, out of breath... but i'm not fooled. my cat has never been more afraid to approach the litterbox, or the couch, or the bedroom. he has her petrified. poor baby.
so if anyone wants a kitty, let us know. you must be a good home, and have plenty of room for him to romp around. another young male cat would be ideal, but no females.
posted by
Kat Reinhart
at
21:37
0
comments
8.01.2005
7.20.2005
i promise, more has been going on than just wallowing in self-pity over my rejection letter. i have a date with an admissions counselor on monday to discuss my application (and, with any luck, bamboozle them into letting me in). and if that fails, then i'll just have to wait until winter, because if i apply to the actual major i want, and write an essay about why i want to do it, and show them my bio 180 grade, there's no way they will turn me down. i'll be like rudy.
edward is hot and annoying in this weather. i'm also out of sake, so i might have to go to the market to retrieve some. i feel like fresh fruit too... perhaps blueberries. mmmmmm.
i've kind of taken over jared's sims game. our sims had a baby who is now a kid. is it weird that the sims brings out my maternal instinct and i very fleetingly find myself wishing i had one? don't worry, i'm not going to have one. not until i've got at least two academic degrees. that's my plan, at least. i almost put the phrase "at least" in those last two sentences a total of four times. i cut it down to two. go me. but whatevs.
speaking of silly little word-shortenings, i got an evite to a fashion industry event that repeatedly refers to "models, photogs and designers." i can hear the girl that sent me the evite saying it, too... "so did you get a photog for this? it was supposed to be tfp..." haha. oh well, i'll probably go, since it's free food and a chance to get boozed up on a thursday night. i need to make some comp cards before then. ergh.
speaking of models, i ran into anna (say it with a long A, not a short one) from the neodandi show on the bus. didn't get to talk to her much since she got on the stop before i got off, but it was cool to see her... odd that we always run into each other. actually, i suppose not, because we live like 7 blocks apart in a neighborhood that is very outdoor friendly. she's pretty cool.
speaking of on the bus, i sat across from an anorexic girl on the way home today. i couldn't stop staring. fortunately she was oblivious, absorbed in her book and her very slowly nibbled baby carrots. this was my inner monologue. "oh god, look at her wrists! holy crap she's hairy. i shouldn't be staring. oh, poor girl. man, watch the self-restraint as she nibbles those carrots. man, i'm lucky i'm not genetically predisposed to anorexia, since there have definitely been times that i've cultivated unhealthy eating habits. wow, her skin looks terrible. look at those calves. i bet she's a runner, too. wow, it sucks to be her." i'm going to hell.
if there were any such thing as hell. ha. instead, i'm going to the market after fresh fruits and sake. mmmmmmm.
posted by
Kat Reinhart
at
18:16
5
comments
7.19.2005
biology test: 110/120. high score: 113. low: 24. average: 84.
number of students in class: 240 something.
number of students in class that just got rejected by the university: 1
something isn't right with this math. but i've got a meeting with an admissions counselor on monday, to talk about my application. and basically tell them to let me in. because something doesn't add up here.
yes, i'm still bitter.
posted by
Kat Reinhart
at
18:28
0
comments
7.14.2005
god fuck fuckity fucking fuckity dammit. motherfuckers fucking fuck fuckity fuck fuck.
i fucking hate the uw admissions fuckers. and i feel like a failure right now.
posted by
Kat Reinhart
at
19:02
0
comments
7.12.2005
7.08.2005
fragments
the rain falling from the uniformly grey sky makes me feel closer to london. two cop cars in the university street tunnel, one unmarked, dark blue. their drivers standing in between the bus lanes, engaged in conversation, their presence absolutely obvious. an elderly sikh man in a turban gets off a bus and waits for another. i feel guilty for wondering how many suspicious eyes he will elicit today. at westlake, a uniformed officer steps on the bus, looks around. he gets off at convention place. evidently terrorists wouldn't strike outside the bus tunnel. i feel an emotion unfamiliar in the presence of law enforcement: slight reassurance.
seattle would be a terrible place to stage an attack, anyway, there's no political value in it, not since '99 anyway. for once i feel a bit glad at the inadequacies of our public transportation, a bit safer that we have no subway.
the bus takes eastlake instead of getting on the freeway. i wonder why.
and on the way back, between the westlake station and university street, the bus stops cold. no announcement from the driver, no apparent reason, just stopped in the middle of the tunnel. ten minutes later it starts again. no explanation.
honestly, i'm more worried about kim jong-il and his rogue nukes, or even mother nature and her volcanoes, but
posted by
Kat Reinhart
at
14:10
1 comments
7.05.2005
big weekend.
flickr is being poopy, but hopefully by the time i'm done writing this i'll have pictures.
so the summer of fun continued last weekend with a jaunt out to tessa's hometown, tahuya. (also known as god's country*).
it was cool because saturday was the annual Tahuya Day parade complete with horses and floats and people in golf carts. and this guy.
i got the feeling that he wasn't particularly dressed up.
tessa's dad makes great bloody marys.
her family enjoys a variety of boating-related activities, including kayaking and water skiing. unfortunately, no pictures of those, as i was paranoid about getting my camera soggy. but it was amazingly fun. i love kayaking. and water skiing. i'm not very good at swimming, though, i've discovered. probably because hood canal is still part of puget sound and thus really really cold, and when i jumped in my body went into slight shock and i couldn't breathe well. also i have no body fat to make me float.
so we spent saturday enjoying tahuya day and then when the tide came in we took the kayaks out, and then took the ski boat out for a zip around the canal. it was overcast and too damn cold to ski, but we enjoyed ourselves thoroughly. i sat in the front of the boat with a shit-eating grin on my face giggling every time tessa hit the throttle or went over another boat's wake.
saturday night we 'sploded things.
and on sunday i got a monstrous sunburn on my legs, because i decided though i needed sunscreen everywhere else, legs don't get sunburned. what. the. fuck. i also got up on the first try on water skis (go me!) and even managed to wakeboard a little. i was the undisputed water sports champion. no one else even went swimming (wussies).
sunday night was fireworks up on the hill. that's where that first panorama shot came from.
and this was me on monday evening when we finally got home, pooped and doing my "i miss kayaking after dinner" face.
*i mean this in an entirely non-ironic way. as in, this is a place that is as god intended. for all theoretical values of "god."
posted by
Kat Reinhart
at
21:35
3
comments
7.01.2005
6.29.2005
omgomgomg
so i just discovered that everyone's favorite top model loser, elyse sewell, has a livejournal!!!
and she actually writes in it and posts pictures and is funny! (duh.) anyway, worth a look, esp if you like... uhh... looking at pictures of models. she is a mistress of self-portraiture as well... i wish i could take a self-portrait that didn't make me want to poop on it. :p
posted by
Kat Reinhart
at
17:02
1 comments
obligatory tom cruise post
so, when this whole tom cruise/katie holmes thing started, i told tessa (and maybe a few other people) my theory: that he's totally gay, and that this whole katie thing is a pr stunt paid for by scientology to keep this gayness under wraps in exchange for him proselytizing all over the place. i knew this to be true, deep down inside. and now, the superficial is corroborating my story. ok, so it's fourth-hand gossip now, but still. i was totally right.
ha.
posted by
Kat Reinhart
at
13:50
1 comments
such a yuppie
i've got a new drink at starbucks. a triple-tall americano. half the price of a double-tall hazelnut nonfat latte, and fewer calories to boot. plus i can add a splash of nonfat milk, some splenda, and a dash of vanilla powder to make it super-yummy without bugging my tummy (fucking lactose).
posted by
Kat Reinhart
at
09:55
0
comments
6.28.2005
long ago in a distant land...
so today during lecture i sat down and noticed THAT GIRL sitting in front of me. i thought to myself, good, if she says anything stupid i can KICK HER. i didn't, i restrained myself. but at one point during the lecture she went to ask a question, and this girl sitting a few chairs over from her (no one between them, but not next to her) leaned over and asked what her question was. taking one for the team! i wanted to give her chocolate or something for that. unfortunately later on the instructor did see her raised hand and bit. dammit. oh well. hopefully we can count on the continued assistance of the altruistic question-answerer. something tells me no though.
samurai jack tonight, yo.
posted by
Kat Reinhart
at
17:50
0
comments
6.24.2005
that girl
why does she have to be in my bio lecture? why, god, why?? you know the girl i'm talking about... she sits in the front row and has frizzy hair and asks STUPID questions. questions that derail our already ramble-prone lecturer and leave 90% of us rolling our eyes. it's not as if this class wasn't already painfully slow, why must you slow us down further?
i can't wait until i'm done with all these intro classes and i can take classes that actually fascinate me.
speaking of fascinating things, you know that construction at the intersection of 15th and pacific? yeah that's the new genome sciences building. genome sciences. how. fucking. awewsome.
i watched a nova special on the genome last night. other than the fact that the interviewer was this british guy that reminded me a little too much of carson from queer eye who asked questions from a complete lay perspective, it was really good. i learned about the proteome. that's like the genome, but instead of genes, they're coding proteins. because that's where the complexity is now... we've decoded the genome into CGATTATAGGCCCGATACCAGT but we can't read that shit. now we need to figure out what all the proteins that the genome codes for are, and what they do. proteins are fucking rad. all they are is long chains of amino acids that fold in a specific way. each protein has a unique shape. its shape is its job. if a protein is misshapen it can't do its job. so we end up with sad genetic disorders like tay-sachs.
chew on this one for awhile. in tay-sachs disease, one (ONE) letter of DNA is missing, so one amino acid in a specific protein doesn't work right. it just happens that this protein is the one that's responsible for removing fat deposits from the brain. so, until the child is about a year old, they appear to be developing normally, then that development slows down, and as the fat deposits suffocate the brain cells, their development actually reverses. these kids never make it much past age 5 or 6, and by the time they're that old, it's like they're an infant again. can't sit up, turn over, swallow, anything. it's absolutely devastating. and all because of one little C or G or A or T out of place.
.
posted by
Kat Reinhart
at
14:13
0
comments
happy things/sad things
happy thing: sandwiches. sad thing: sandwiches which are all gone.
posted by
Kat Reinhart
at
13:56
0
comments
6.21.2005
ohh, gregor mendel
so i'm back at work after my first bio 180 lecture. it looks like, at this point, there's a roughly 84% chance of me getting into the class. There are 5 spots open and 6 people raised their hands in lecture to the question, "who is trying to get into the class?" so that's pretty rad. the class looks like it'll pretty much be a breeze, but i'm going to actually buckle down and study hard no matter how easy it seems, so i can be that fucker that makes the curve. :D though i won't know for sure until thursday whether i'm in or not. i have to go to the first lab section thursday morning and hope.
i totally forgot to bring something to write with to lecture today, so i had to borrow a pen. on the first day. why does that always happen to me? :p oh well.
anyway this class is on evolution, mendelian genetics, and biodiversity. the biodiversity part sounds super-cool because there are field trips involved. one of which is to friday harbor, and one of which is to the olympic peninsula. fuckin' sweet. i really want to do the friday harbor one. because san juan island has to be beautiful. also, i love sea critters.
meh. so now i have to go buy the lab manual. and if i get into the class i'll have to buy the textbook too. and pay tuition. :p i'm pretty sure my parents are going to help out with that one... since i'm poor.
so now i'm stuck at work for a long time since i skipped out on 2 hours to go to class. tomorrow i'm going to get up earlier so i can get to work by about 7:30 or 8 so that i don't have to stay until 7pm to make up for my missed lecture time. whee.
posted by
Kat Reinhart
at
14:01
6
comments
6.19.2005
all the successful ones are dropouts
OK, I know this news is like a week old, but it's been circulating the net so much that I kind of feel I need to comment on it. It's about Steve Jobs speaking at Stanford's graduation. You can find the text of his speech here. It's definitely worth a read.
So, speaking at the graduation that, for all intents and purposes, should have been my own, Steve Jobs, who never graduated from college, says that dropping out was the best thing he ever did. Really, this speech did a lot for me this past week - I have been having pangs of guilt - feeling like I'm a lazy fuck, like i'm a failure, like I should have just stuck it out. But really, when I think hard about it (or even not that hard) I remember just how painfully unhappy I was those last two quarters at Stanford, and remember that if I'd graduated last Sunday, it would have been in Product Design, which is a very fucking awesome major, but not what I'm good at at all. I probably would have been a miserable failure, I know I never would have gotten a job with Apple or Ideo, and well, I'm just not all that creative at heart, as much as I wish I were. And now that I've found what I really am passionate about, I really am a lot happier. :)
(ok, living with my super-hot amazing boyfriend doesn't hurt, either. ;)
posted by
Kat Reinhart
at
15:48
0
comments
6.17.2005
is wayne brady gonna have to chokeabitch?
i hate people today. all of them. i've been having violent fantasies all week. this morning on the bus i repeatedly shot a kid on the bus with my pretend-gun because he kept asking the driver dumbass questions. also because he was poorly dressed with thick glasses with clip-ons. honestly, who wears clip-ons anymore? at least they weren't flipped up. i guess i'm just prejudiced against the socially inept.
then today before lunch some bitch called demanding payment for some cd-rom her company sent me without solicitation. when they called before it was shipped i said, no, i don't want it! and then they sent it. and i was like, ok, whatever. then today, i got a $417 invoice for the damn thing. for a fucking CD-ROM! i mean, honestly, if you're going to overcharge, at least use up-to-date media. i could deal with paying $417 for a holographic information card. or maybe a 2GB memory stick. but a CD-ROM, hell no. so i sat there and tried to get it resolved, all the while wishing i had a "choke-a-bitch" button on my phone.
then on the bus on the way back from lunch some coworker of jared's started going off on pussy liberals talking about their feelings. oh. my. god. i only had 2 blocks until my office so i kept my mouth shut, all the while seething inside as these two coworkers of his proceeded to talk about why mexicans are bad for the u.s. economy and how they are just here to rape and kill people. duh, that's why our prison system is 30% immigrants! yeah, well maybe these people became violent criminals after they arrived in the us and realized how fucking stupid the people here are, and decided that maybe they deserve to be killed.
i also had a violent episode on wednesday night playing mario party. i had hoped that would get all the anger out of my system, but nope, people kept on pissing me off yesterday and today. dammit. at least he didn't turn around and call me an abusive girlfriend and a horrible person and make me feel guilty on top of my anger like a certain ex of mine did.
so yeah, it's been anger-management week for kat. i just don't get why i've been so twacked out. i blame the new birth control. i suppose it's a small price to pay to not worry about popping out a kid or two while i'm not paying attention...
posted by
Kat Reinhart
at
14:06
4
comments
6.14.2005
had an odd dream last night - it was about my cousin's wedding. (he's getting married in july. which is so weird to me.) anyway, we were getting ready for the wedding, and evidently it turned out that his fiancee is some minor royalty, so the queen of england was going to be there, even though it was a really informal, small ceremony. so everyone was fussing about, getting ready for the queen. and the wedding. there was also something in there about trying to get my mom set up to use my old ipod (as if i had an old one going unused), but we couldn't find a dongle (not sure why it was called that) to convert firewire to usb, and the ipod kept giving us friendly error messages. it was kind of funny and sarcastic. then, as we were sitting down for the wedding (someone had offered me a juice with vodka in it - seemed a little early, but i took it since it was stressful times, the queen was coming!) and suddenly a tree in the yard was on fire. so i started screaming and pointing, and no one would look the right way. i tried to call 911, but i got a phone maze ("thank you for calling 911 emergency services. all our agents are currently on the line.") and then i woke up.
posted by
Kat Reinhart
at
09:16
2
comments
6.13.2005
moanday...
so the bus was 20 minutes late this morning, prompting myself and probably everyone else waiting for it to wonder if i'd missed it. turns out i hadn't, it was just 20 minutes late. without explaination. meh. so i was a little late getting into work this morning, and my double-tall hazelnut nonfat latte (yes i hate myself for using that many words to order a fucking coffee) completely failed to wake me up. so i spent most of today in a half-awake stupor. i did read some stuff on wikipedia about g-proteins, and rod and cone cells, and kind of how they work, which was neat. i also learned about cnidarians and that if you take two different kinds of sponges (the simple aquatic animal, not the kind you use to wash dishes) and put them in a blender and make sponge-shake, then let them sit and settle for a few weeks, the sponge cells will reassociate with their own kind and reform sponges. they sort themselves out. pretty fucking cool, huh. kind of makes me wish i had my own sponges to play with.
which brings me to the next car in my train of thought. i want to set up a marine tank. with live sand and rock and maybe a few fishies. eventually i want to have a huge coral tank with some sweet anemones and shit, but that stuff is expensive. goldfish are cute, but boring. i want itty bitty critters crawling around in my substrate.
this weekend was pretty cool. friday night andy (with whom i attended high school, back in helltexas) and some college buddies dropped by on their post-collegiate road trip. went to pies and pints for dinner, where we ran into the tessanator and had a lovely meal. went back to our apartment and drank. a lot.
saturday was my grandma's birthday, so jared and i went over to bellevue to hang with the Fam for the afternoon. saw plenty of family-types. my cousin krissy came over to our apartment and hung out for awhile, mostly to escape barney, who had infected our grandparents' television (much to the delight of almost-four Lauren, who is loud and talkative now). fuck barney. so then after she went back to bellevue, we headed out to a par-tay at some friends of tessa's on cap hill. much beer was drunk. met a new blogger chick who seemed pretty cool. saved tessa from certain doom at the hands of an asshole. danced wildly to annie, the swedish pop star. (note to self: find her music.) and other such party-tastic activities.
sunday i got a wee sunburn. hooray! i'm a little bit tan now (though still solidly in the "ridiculously white" category). also, had a rehearsal for the upcoming neodandi show. it's in july. we're going to have 3-hour rehearsals for this one. whee.
why do i always end up doing epic summary posts instead of shorter on-the-fly posts??
posted by
Kat Reinhart
at
18:27
5
comments
6.09.2005
the perils of living in the northwest
i had a dream last night that i still remember pretty vividly, so i figure i'll share it. it started with an earthquake. i can't remember what building i was in, probably not any real building, but i remember feeling the ground moving in one direction, like a large chunk of land mass was sliding. so i jumped up and stood in a doorframe like you're supposed to do in an earthquake. only it didn't stop, it just kept going. i could see where it was going - we kept sliding out into the sound, then busted through some bridge (if there were a bridge across the sound around here), and kept on sliding until we were pretty far from where we started. so we decided to evacuate. at first this was done by running as fast as we could in the same direction as we were moving, trying to get to where we could see the ocean. my dad was there. he said that we had to get off of the moving land before it fell off the continental shelf. that sounded scary. suddenly there was a big hill in front of us (that i remember someone called "mt. hill." ha.) that i couldn't make it up. and then we saw other people, and they were all going the other direction, back towards the land. at this point we realized that what had happened was mt. rainier had blown, and we were on one of the lahars that was moving out to sea. so we started moving in the other direction, first stopping back at our house to grab stuff. i tried to stuff frida into my backpack but decided against it. i think i ended up carrying her off. so then we got into a car somehow and were driving back towards the land, trying to outrun the still-moving land mass and get to safety. someone mentioned something about "you think we're screwed, i just heard that car dealership central is completely demolished." somehow i knew that car dealership central referred to the renton/auburn valley. we kept on going, driving as fast as we could in the clogged 2-lane street to get to safety. then i woke up.
so then i started thinking about the inaccuracies of my dream. first of all, lahars don't carry large land masses and things with them, they just blow them out of existence. second, if mt. rainier really exploded, we here in seattle would have at least some advance warning to evacuate. i'd put my kitty in her carrier, rather than shoving her in a backpack or carrying her by hand. and then we'd head north on i-5, as fast as traffic would allow. and auburn and renton would probably be nonexistent. these are things you gotta think about, living in the shadow of the most dangerous volcano in the country. not obsess about, mind you, but at least be aware of, so should that day ever come, you can deal with it without completely panicking.
posted by
Kat Reinhart
at
09:41
3
comments
6.06.2005
department of narcissism
new flickr pictures from the fashion show - by robert contreras... some of these turned out really cute. check them out. i'm slowly starting to feel like maybe i can photograph well after all. now i gotta learn how to do my own makeup :/ 'cause that's the key.
camping was swell. there are camping pics up there on flickr too. you can see them here. we should do that again sometime soon. :D
posted by
Kat Reinhart
at
22:28
0
comments
6.03.2005
i give my hand, you take my arm
Thanks, Mike, for passing me the baton. I don't usually do this sort of thing, but I'm bored, waiting for everyone to get here so we can go camping, and you told me to, so I will.
Total volume of music on my computer: According to itunes, 2792 songs, 8.7 days, 12.95 GB. I know, I'm a n00b. But I lost all when I upgraded to the Mac.
The last CD I bought: The Life Aquatic with Steve Zissou OST. It arrived in the mail today and it is awesome.
Song playing right now: "Starman" written by David Bowie, translated into the Portuguese and performed by Seu Jorge (who appeared as Pele in the movie). Acoustic Bowie in Portuguese. What could be better??
Five songs I listen to a lot, or that mean a lot to me:
Such Great Heights, The Postal Service. It's "our" song.
The Only Living Boy in New York, by Simon and Garfunkel. The Garden State soundtrack is amazing, and I figured if I could only pick one song off the album, it'd be this one.
Welcome Home feat. Mike Ladd, by Daedalus. Again, amazing album, favorite song. It's really smooth rap lyrics over an awesomely melodical song. Plus he uses the word "megadebauchalopolis" which I think is awesome.
It's A Fire, Portishead.
Love Ridden, Fiona Apple. This album (When the pawn hits...) carried me through some of my angstiest high school years. I still know the whole title (it's in the guiness book for being the longest album title ever) - ask me sometime.
Five people to whom I'm passing the baton: Jared, Tessa, Ruben, Andy and Lauren. Shit, I don't even know if five people read this damn thing.
That was fun. We now return to our regularly scheduled programming.
posted by
Kat Reinhart
at
17:32
1 comments
