that girl

why does she have to be in my bio lecture? why, god, why?? you know the girl i'm talking about... she sits in the front row and has frizzy hair and asks STUPID questions. questions that derail our already ramble-prone lecturer and leave 90% of us rolling our eyes. it's not as if this class wasn't already painfully slow, why must you slow us down further?

i can't wait until i'm done with all these intro classes and i can take classes that actually fascinate me.

speaking of fascinating things, you know that construction at the intersection of 15th and pacific? yeah that's the new genome sciences building. genome sciences. how. fucking. awewsome.

i watched a nova special on the genome last night. other than the fact that the interviewer was this british guy that reminded me a little too much of carson from queer eye who asked questions from a complete lay perspective, it was really good. i learned about the proteome. that's like the genome, but instead of genes, they're coding proteins. because that's where the complexity is now... we've decoded the genome into CGATTATAGGCCCGATACCAGT but we can't read that shit. now we need to figure out what all the proteins that the genome codes for are, and what they do. proteins are fucking rad. all they are is long chains of amino acids that fold in a specific way. each protein has a unique shape. its shape is its job. if a protein is misshapen it can't do its job. so we end up with sad genetic disorders like tay-sachs.

chew on this one for awhile. in tay-sachs disease, one (ONE) letter of DNA is missing, so one amino acid in a specific protein doesn't work right. it just happens that this protein is the one that's responsible for removing fat deposits from the brain. so, until the child is about a year old, they appear to be developing normally, then that development slows down, and as the fat deposits suffocate the brain cells, their development actually reverses. these kids never make it much past age 5 or 6, and by the time they're that old, it's like they're an infant again. can't sit up, turn over, swallow, anything. it's absolutely devastating. and all because of one little C or G or A or T out of place.

.