8.01.2005
7.20.2005
i promise, more has been going on than just wallowing in self-pity over my rejection letter. i have a date with an admissions counselor on monday to discuss my application (and, with any luck, bamboozle them into letting me in). and if that fails, then i'll just have to wait until winter, because if i apply to the actual major i want, and write an essay about why i want to do it, and show them my bio 180 grade, there's no way they will turn me down. i'll be like rudy.
edward is hot and annoying in this weather. i'm also out of sake, so i might have to go to the market to retrieve some. i feel like fresh fruit too... perhaps blueberries. mmmmmm.
i've kind of taken over jared's sims game. our sims had a baby who is now a kid. is it weird that the sims brings out my maternal instinct and i very fleetingly find myself wishing i had one? don't worry, i'm not going to have one. not until i've got at least two academic degrees. that's my plan, at least. i almost put the phrase "at least" in those last two sentences a total of four times. i cut it down to two. go me. but whatevs.
speaking of silly little word-shortenings, i got an evite to a fashion industry event that repeatedly refers to "models, photogs and designers." i can hear the girl that sent me the evite saying it, too... "so did you get a photog for this? it was supposed to be tfp..." haha. oh well, i'll probably go, since it's free food and a chance to get boozed up on a thursday night. i need to make some comp cards before then. ergh.
speaking of models, i ran into anna (say it with a long A, not a short one) from the neodandi show on the bus. didn't get to talk to her much since she got on the stop before i got off, but it was cool to see her... odd that we always run into each other. actually, i suppose not, because we live like 7 blocks apart in a neighborhood that is very outdoor friendly. she's pretty cool.
speaking of on the bus, i sat across from an anorexic girl on the way home today. i couldn't stop staring. fortunately she was oblivious, absorbed in her book and her very slowly nibbled baby carrots. this was my inner monologue. "oh god, look at her wrists! holy crap she's hairy. i shouldn't be staring. oh, poor girl. man, watch the self-restraint as she nibbles those carrots. man, i'm lucky i'm not genetically predisposed to anorexia, since there have definitely been times that i've cultivated unhealthy eating habits. wow, her skin looks terrible. look at those calves. i bet she's a runner, too. wow, it sucks to be her." i'm going to hell.
if there were any such thing as hell. ha. instead, i'm going to the market after fresh fruits and sake. mmmmmmm.
posted by
Kat Reinhart
at
18:16
5
comments
7.19.2005
biology test: 110/120. high score: 113. low: 24. average: 84.
number of students in class: 240 something.
number of students in class that just got rejected by the university: 1
something isn't right with this math. but i've got a meeting with an admissions counselor on monday, to talk about my application. and basically tell them to let me in. because something doesn't add up here.
yes, i'm still bitter.
posted by
Kat Reinhart
at
18:28
0
comments
7.14.2005
god fuck fuckity fucking fuckity dammit. motherfuckers fucking fuck fuckity fuck fuck.
i fucking hate the uw admissions fuckers. and i feel like a failure right now.
posted by
Kat Reinhart
at
19:02
0
comments
7.12.2005
7.08.2005
fragments
the rain falling from the uniformly grey sky makes me feel closer to london. two cop cars in the university street tunnel, one unmarked, dark blue. their drivers standing in between the bus lanes, engaged in conversation, their presence absolutely obvious. an elderly sikh man in a turban gets off a bus and waits for another. i feel guilty for wondering how many suspicious eyes he will elicit today. at westlake, a uniformed officer steps on the bus, looks around. he gets off at convention place. evidently terrorists wouldn't strike outside the bus tunnel. i feel an emotion unfamiliar in the presence of law enforcement: slight reassurance.
seattle would be a terrible place to stage an attack, anyway, there's no political value in it, not since '99 anyway. for once i feel a bit glad at the inadequacies of our public transportation, a bit safer that we have no subway.
the bus takes eastlake instead of getting on the freeway. i wonder why.
and on the way back, between the westlake station and university street, the bus stops cold. no announcement from the driver, no apparent reason, just stopped in the middle of the tunnel. ten minutes later it starts again. no explanation.
honestly, i'm more worried about kim jong-il and his rogue nukes, or even mother nature and her volcanoes, but
posted by
Kat Reinhart
at
14:10
1 comments
7.05.2005
big weekend.
flickr is being poopy, but hopefully by the time i'm done writing this i'll have pictures.
so the summer of fun continued last weekend with a jaunt out to tessa's hometown, tahuya. (also known as god's country*).
it was cool because saturday was the annual Tahuya Day parade complete with horses and floats and people in golf carts. and this guy.
i got the feeling that he wasn't particularly dressed up.
tessa's dad makes great bloody marys.
her family enjoys a variety of boating-related activities, including kayaking and water skiing. unfortunately, no pictures of those, as i was paranoid about getting my camera soggy. but it was amazingly fun. i love kayaking. and water skiing. i'm not very good at swimming, though, i've discovered. probably because hood canal is still part of puget sound and thus really really cold, and when i jumped in my body went into slight shock and i couldn't breathe well. also i have no body fat to make me float.
so we spent saturday enjoying tahuya day and then when the tide came in we took the kayaks out, and then took the ski boat out for a zip around the canal. it was overcast and too damn cold to ski, but we enjoyed ourselves thoroughly. i sat in the front of the boat with a shit-eating grin on my face giggling every time tessa hit the throttle or went over another boat's wake.
saturday night we 'sploded things.
and on sunday i got a monstrous sunburn on my legs, because i decided though i needed sunscreen everywhere else, legs don't get sunburned. what. the. fuck. i also got up on the first try on water skis (go me!) and even managed to wakeboard a little. i was the undisputed water sports champion. no one else even went swimming (wussies).
sunday night was fireworks up on the hill. that's where that first panorama shot came from.
and this was me on monday evening when we finally got home, pooped and doing my "i miss kayaking after dinner" face.
*i mean this in an entirely non-ironic way. as in, this is a place that is as god intended. for all theoretical values of "god."
posted by
Kat Reinhart
at
21:35
3
comments
7.01.2005
6.29.2005
omgomgomg
so i just discovered that everyone's favorite top model loser, elyse sewell, has a livejournal!!!
and she actually writes in it and posts pictures and is funny! (duh.) anyway, worth a look, esp if you like... uhh... looking at pictures of models. she is a mistress of self-portraiture as well... i wish i could take a self-portrait that didn't make me want to poop on it. :p
posted by
Kat Reinhart
at
17:02
1 comments
obligatory tom cruise post
so, when this whole tom cruise/katie holmes thing started, i told tessa (and maybe a few other people) my theory: that he's totally gay, and that this whole katie thing is a pr stunt paid for by scientology to keep this gayness under wraps in exchange for him proselytizing all over the place. i knew this to be true, deep down inside. and now, the superficial is corroborating my story. ok, so it's fourth-hand gossip now, but still. i was totally right.
ha.
posted by
Kat Reinhart
at
13:50
1 comments
such a yuppie
i've got a new drink at starbucks. a triple-tall americano. half the price of a double-tall hazelnut nonfat latte, and fewer calories to boot. plus i can add a splash of nonfat milk, some splenda, and a dash of vanilla powder to make it super-yummy without bugging my tummy (fucking lactose).
posted by
Kat Reinhart
at
09:55
0
comments
6.28.2005
long ago in a distant land...
so today during lecture i sat down and noticed THAT GIRL sitting in front of me. i thought to myself, good, if she says anything stupid i can KICK HER. i didn't, i restrained myself. but at one point during the lecture she went to ask a question, and this girl sitting a few chairs over from her (no one between them, but not next to her) leaned over and asked what her question was. taking one for the team! i wanted to give her chocolate or something for that. unfortunately later on the instructor did see her raised hand and bit. dammit. oh well. hopefully we can count on the continued assistance of the altruistic question-answerer. something tells me no though.
samurai jack tonight, yo.
posted by
Kat Reinhart
at
17:50
0
comments
6.24.2005
that girl
why does she have to be in my bio lecture? why, god, why?? you know the girl i'm talking about... she sits in the front row and has frizzy hair and asks STUPID questions. questions that derail our already ramble-prone lecturer and leave 90% of us rolling our eyes. it's not as if this class wasn't already painfully slow, why must you slow us down further?
i can't wait until i'm done with all these intro classes and i can take classes that actually fascinate me.
speaking of fascinating things, you know that construction at the intersection of 15th and pacific? yeah that's the new genome sciences building. genome sciences. how. fucking. awewsome.
i watched a nova special on the genome last night. other than the fact that the interviewer was this british guy that reminded me a little too much of carson from queer eye who asked questions from a complete lay perspective, it was really good. i learned about the proteome. that's like the genome, but instead of genes, they're coding proteins. because that's where the complexity is now... we've decoded the genome into CGATTATAGGCCCGATACCAGT but we can't read that shit. now we need to figure out what all the proteins that the genome codes for are, and what they do. proteins are fucking rad. all they are is long chains of amino acids that fold in a specific way. each protein has a unique shape. its shape is its job. if a protein is misshapen it can't do its job. so we end up with sad genetic disorders like tay-sachs.
chew on this one for awhile. in tay-sachs disease, one (ONE) letter of DNA is missing, so one amino acid in a specific protein doesn't work right. it just happens that this protein is the one that's responsible for removing fat deposits from the brain. so, until the child is about a year old, they appear to be developing normally, then that development slows down, and as the fat deposits suffocate the brain cells, their development actually reverses. these kids never make it much past age 5 or 6, and by the time they're that old, it's like they're an infant again. can't sit up, turn over, swallow, anything. it's absolutely devastating. and all because of one little C or G or A or T out of place.
.
posted by
Kat Reinhart
at
14:13
0
comments
happy things/sad things
happy thing: sandwiches. sad thing: sandwiches which are all gone.
posted by
Kat Reinhart
at
13:56
0
comments
6.21.2005
ohh, gregor mendel
so i'm back at work after my first bio 180 lecture. it looks like, at this point, there's a roughly 84% chance of me getting into the class. There are 5 spots open and 6 people raised their hands in lecture to the question, "who is trying to get into the class?" so that's pretty rad. the class looks like it'll pretty much be a breeze, but i'm going to actually buckle down and study hard no matter how easy it seems, so i can be that fucker that makes the curve. :D though i won't know for sure until thursday whether i'm in or not. i have to go to the first lab section thursday morning and hope.
i totally forgot to bring something to write with to lecture today, so i had to borrow a pen. on the first day. why does that always happen to me? :p oh well.
anyway this class is on evolution, mendelian genetics, and biodiversity. the biodiversity part sounds super-cool because there are field trips involved. one of which is to friday harbor, and one of which is to the olympic peninsula. fuckin' sweet. i really want to do the friday harbor one. because san juan island has to be beautiful. also, i love sea critters.
meh. so now i have to go buy the lab manual. and if i get into the class i'll have to buy the textbook too. and pay tuition. :p i'm pretty sure my parents are going to help out with that one... since i'm poor.
so now i'm stuck at work for a long time since i skipped out on 2 hours to go to class. tomorrow i'm going to get up earlier so i can get to work by about 7:30 or 8 so that i don't have to stay until 7pm to make up for my missed lecture time. whee.
posted by
Kat Reinhart
at
14:01
6
comments
6.19.2005
all the successful ones are dropouts
OK, I know this news is like a week old, but it's been circulating the net so much that I kind of feel I need to comment on it. It's about Steve Jobs speaking at Stanford's graduation. You can find the text of his speech here. It's definitely worth a read.
So, speaking at the graduation that, for all intents and purposes, should have been my own, Steve Jobs, who never graduated from college, says that dropping out was the best thing he ever did. Really, this speech did a lot for me this past week - I have been having pangs of guilt - feeling like I'm a lazy fuck, like i'm a failure, like I should have just stuck it out. But really, when I think hard about it (or even not that hard) I remember just how painfully unhappy I was those last two quarters at Stanford, and remember that if I'd graduated last Sunday, it would have been in Product Design, which is a very fucking awesome major, but not what I'm good at at all. I probably would have been a miserable failure, I know I never would have gotten a job with Apple or Ideo, and well, I'm just not all that creative at heart, as much as I wish I were. And now that I've found what I really am passionate about, I really am a lot happier. :)
(ok, living with my super-hot amazing boyfriend doesn't hurt, either. ;)
posted by
Kat Reinhart
at
15:48
0
comments
6.17.2005
is wayne brady gonna have to chokeabitch?
i hate people today. all of them. i've been having violent fantasies all week. this morning on the bus i repeatedly shot a kid on the bus with my pretend-gun because he kept asking the driver dumbass questions. also because he was poorly dressed with thick glasses with clip-ons. honestly, who wears clip-ons anymore? at least they weren't flipped up. i guess i'm just prejudiced against the socially inept.
then today before lunch some bitch called demanding payment for some cd-rom her company sent me without solicitation. when they called before it was shipped i said, no, i don't want it! and then they sent it. and i was like, ok, whatever. then today, i got a $417 invoice for the damn thing. for a fucking CD-ROM! i mean, honestly, if you're going to overcharge, at least use up-to-date media. i could deal with paying $417 for a holographic information card. or maybe a 2GB memory stick. but a CD-ROM, hell no. so i sat there and tried to get it resolved, all the while wishing i had a "choke-a-bitch" button on my phone.
then on the bus on the way back from lunch some coworker of jared's started going off on pussy liberals talking about their feelings. oh. my. god. i only had 2 blocks until my office so i kept my mouth shut, all the while seething inside as these two coworkers of his proceeded to talk about why mexicans are bad for the u.s. economy and how they are just here to rape and kill people. duh, that's why our prison system is 30% immigrants! yeah, well maybe these people became violent criminals after they arrived in the us and realized how fucking stupid the people here are, and decided that maybe they deserve to be killed.
i also had a violent episode on wednesday night playing mario party. i had hoped that would get all the anger out of my system, but nope, people kept on pissing me off yesterday and today. dammit. at least he didn't turn around and call me an abusive girlfriend and a horrible person and make me feel guilty on top of my anger like a certain ex of mine did.
so yeah, it's been anger-management week for kat. i just don't get why i've been so twacked out. i blame the new birth control. i suppose it's a small price to pay to not worry about popping out a kid or two while i'm not paying attention...
posted by
Kat Reinhart
at
14:06
4
comments
6.14.2005
had an odd dream last night - it was about my cousin's wedding. (he's getting married in july. which is so weird to me.) anyway, we were getting ready for the wedding, and evidently it turned out that his fiancee is some minor royalty, so the queen of england was going to be there, even though it was a really informal, small ceremony. so everyone was fussing about, getting ready for the queen. and the wedding. there was also something in there about trying to get my mom set up to use my old ipod (as if i had an old one going unused), but we couldn't find a dongle (not sure why it was called that) to convert firewire to usb, and the ipod kept giving us friendly error messages. it was kind of funny and sarcastic. then, as we were sitting down for the wedding (someone had offered me a juice with vodka in it - seemed a little early, but i took it since it was stressful times, the queen was coming!) and suddenly a tree in the yard was on fire. so i started screaming and pointing, and no one would look the right way. i tried to call 911, but i got a phone maze ("thank you for calling 911 emergency services. all our agents are currently on the line.") and then i woke up.
posted by
Kat Reinhart
at
09:16
2
comments
6.13.2005
moanday...
so the bus was 20 minutes late this morning, prompting myself and probably everyone else waiting for it to wonder if i'd missed it. turns out i hadn't, it was just 20 minutes late. without explaination. meh. so i was a little late getting into work this morning, and my double-tall hazelnut nonfat latte (yes i hate myself for using that many words to order a fucking coffee) completely failed to wake me up. so i spent most of today in a half-awake stupor. i did read some stuff on wikipedia about g-proteins, and rod and cone cells, and kind of how they work, which was neat. i also learned about cnidarians and that if you take two different kinds of sponges (the simple aquatic animal, not the kind you use to wash dishes) and put them in a blender and make sponge-shake, then let them sit and settle for a few weeks, the sponge cells will reassociate with their own kind and reform sponges. they sort themselves out. pretty fucking cool, huh. kind of makes me wish i had my own sponges to play with.
which brings me to the next car in my train of thought. i want to set up a marine tank. with live sand and rock and maybe a few fishies. eventually i want to have a huge coral tank with some sweet anemones and shit, but that stuff is expensive. goldfish are cute, but boring. i want itty bitty critters crawling around in my substrate.
this weekend was pretty cool. friday night andy (with whom i attended high school, back in helltexas) and some college buddies dropped by on their post-collegiate road trip. went to pies and pints for dinner, where we ran into the tessanator and had a lovely meal. went back to our apartment and drank. a lot.
saturday was my grandma's birthday, so jared and i went over to bellevue to hang with the Fam for the afternoon. saw plenty of family-types. my cousin krissy came over to our apartment and hung out for awhile, mostly to escape barney, who had infected our grandparents' television (much to the delight of almost-four Lauren, who is loud and talkative now). fuck barney. so then after she went back to bellevue, we headed out to a par-tay at some friends of tessa's on cap hill. much beer was drunk. met a new blogger chick who seemed pretty cool. saved tessa from certain doom at the hands of an asshole. danced wildly to annie, the swedish pop star. (note to self: find her music.) and other such party-tastic activities.
sunday i got a wee sunburn. hooray! i'm a little bit tan now (though still solidly in the "ridiculously white" category). also, had a rehearsal for the upcoming neodandi show. it's in july. we're going to have 3-hour rehearsals for this one. whee.
why do i always end up doing epic summary posts instead of shorter on-the-fly posts??
posted by
Kat Reinhart
at
18:27
5
comments
6.09.2005
the perils of living in the northwest
i had a dream last night that i still remember pretty vividly, so i figure i'll share it. it started with an earthquake. i can't remember what building i was in, probably not any real building, but i remember feeling the ground moving in one direction, like a large chunk of land mass was sliding. so i jumped up and stood in a doorframe like you're supposed to do in an earthquake. only it didn't stop, it just kept going. i could see where it was going - we kept sliding out into the sound, then busted through some bridge (if there were a bridge across the sound around here), and kept on sliding until we were pretty far from where we started. so we decided to evacuate. at first this was done by running as fast as we could in the same direction as we were moving, trying to get to where we could see the ocean. my dad was there. he said that we had to get off of the moving land before it fell off the continental shelf. that sounded scary. suddenly there was a big hill in front of us (that i remember someone called "mt. hill." ha.) that i couldn't make it up. and then we saw other people, and they were all going the other direction, back towards the land. at this point we realized that what had happened was mt. rainier had blown, and we were on one of the lahars that was moving out to sea. so we started moving in the other direction, first stopping back at our house to grab stuff. i tried to stuff frida into my backpack but decided against it. i think i ended up carrying her off. so then we got into a car somehow and were driving back towards the land, trying to outrun the still-moving land mass and get to safety. someone mentioned something about "you think we're screwed, i just heard that car dealership central is completely demolished." somehow i knew that car dealership central referred to the renton/auburn valley. we kept on going, driving as fast as we could in the clogged 2-lane street to get to safety. then i woke up.
so then i started thinking about the inaccuracies of my dream. first of all, lahars don't carry large land masses and things with them, they just blow them out of existence. second, if mt. rainier really exploded, we here in seattle would have at least some advance warning to evacuate. i'd put my kitty in her carrier, rather than shoving her in a backpack or carrying her by hand. and then we'd head north on i-5, as fast as traffic would allow. and auburn and renton would probably be nonexistent. these are things you gotta think about, living in the shadow of the most dangerous volcano in the country. not obsess about, mind you, but at least be aware of, so should that day ever come, you can deal with it without completely panicking.
posted by
Kat Reinhart
at
09:41
3
comments
